ID: 1065775519

View in Genome Browser
Species Human (GRCh38)
Location 10:29116001-29116023
Sequence TGGCTCACGATTCTGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2671
Summary {0: 4, 1: 38, 2: 174, 3: 628, 4: 1827}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775519_1065775524 15 Left 1065775519 10:29116001-29116023 CCGGCCACCAGAATCGTGAGCCA 0: 4
1: 38
2: 174
3: 628
4: 1827
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775519 Original CRISPR TGGCTCACGATTCTGGTGGC CGG (reversed) Intergenic
Too many off-targets to display for this crispr