ID: 1065775520

View in Genome Browser
Species Human (GRCh38)
Location 10:29116005-29116027
Sequence TATTTGGCTCACGATTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775520_1065775524 11 Left 1065775520 10:29116005-29116027 CCACCAGAATCGTGAGCCAAATA No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775520 Original CRISPR TATTTGGCTCACGATTCTGG TGG (reversed) Intergenic
No off target data available for this crispr