ID: 1065775521

View in Genome Browser
Species Human (GRCh38)
Location 10:29116008-29116030
Sequence GTTTATTTGGCTCACGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775521_1065775528 30 Left 1065775521 10:29116008-29116030 CCAGAATCGTGAGCCAAATAAAC No data
Right 1065775528 10:29116061-29116083 GCATTCTATCAATGCAAAACAGG No data
1065775521_1065775524 8 Left 1065775521 10:29116008-29116030 CCAGAATCGTGAGCCAAATAAAC No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775521 Original CRISPR GTTTATTTGGCTCACGATTC TGG (reversed) Intergenic
No off target data available for this crispr