ID: 1065775522

View in Genome Browser
Species Human (GRCh38)
Location 10:29116021-29116043
Sequence ATAAAGAAAAGAGGTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15335
Summary {0: 552, 1: 2956, 2: 4166, 3: 3533, 4: 4128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775522_1065775528 17 Left 1065775522 10:29116021-29116043 CCAAATAAACCTCTTTTCTTTAT 0: 552
1: 2956
2: 4166
3: 3533
4: 4128
Right 1065775528 10:29116061-29116083 GCATTCTATCAATGCAAAACAGG No data
1065775522_1065775524 -5 Left 1065775522 10:29116021-29116043 CCAAATAAACCTCTTTTCTTTAT 0: 552
1: 2956
2: 4166
3: 3533
4: 4128
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775522 Original CRISPR ATAAAGAAAAGAGGTTTATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr