ID: 1065775524

View in Genome Browser
Species Human (GRCh38)
Location 10:29116039-29116061
Sequence TTTATAAATTACCCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46855
Summary {0: 782, 1: 8120, 2: 14095, 3: 13596, 4: 10262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775518_1065775524 16 Left 1065775518 10:29116000-29116022 CCCGGCCACCAGAATCGTGAGCC No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262
1065775522_1065775524 -5 Left 1065775522 10:29116021-29116043 CCAAATAAACCTCTTTTCTTTAT 0: 552
1: 2956
2: 4166
3: 3533
4: 4128
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262
1065775519_1065775524 15 Left 1065775519 10:29116001-29116023 CCGGCCACCAGAATCGTGAGCCA 0: 4
1: 38
2: 174
3: 628
4: 1827
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262
1065775520_1065775524 11 Left 1065775520 10:29116005-29116027 CCACCAGAATCGTGAGCCAAATA No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262
1065775521_1065775524 8 Left 1065775521 10:29116008-29116030 CCAGAATCGTGAGCCAAATAAAC No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262
1065775517_1065775524 19 Left 1065775517 10:29115997-29116019 CCTCCCGGCCACCAGAATCGTGA No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG 0: 782
1: 8120
2: 14095
3: 13596
4: 10262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775524 Original CRISPR TTTATAAATTACCCAGCCTC AGG Intergenic
Too many off-targets to display for this crispr