ID: 1065778997

View in Genome Browser
Species Human (GRCh38)
Location 10:29149372-29149394
Sequence CAAAAGCTAGCCTGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065778997_1065779000 -5 Left 1065778997 10:29149372-29149394 CCACCACGCCAGGCTAGCTTTTG No data
Right 1065779000 10:29149390-29149412 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1065778997_1065779001 -4 Left 1065778997 10:29149372-29149394 CCACCACGCCAGGCTAGCTTTTG No data
Right 1065779001 10:29149391-29149413 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
1065778997_1065779003 16 Left 1065778997 10:29149372-29149394 CCACCACGCCAGGCTAGCTTTTG No data
Right 1065779003 10:29149411-29149433 GGGGTTTCACCATGTTGCCCAGG 0: 5155
1: 83805
2: 175580
3: 223117
4: 197098
1065778997_1065779004 20 Left 1065778997 10:29149372-29149394 CCACCACGCCAGGCTAGCTTTTG No data
Right 1065779004 10:29149415-29149437 TTTCACCATGTTGCCCAGGCTGG 0: 9194
1: 113135
2: 189235
3: 228006
4: 255846
1065778997_1065779002 -3 Left 1065778997 10:29149372-29149394 CCACCACGCCAGGCTAGCTTTTG No data
Right 1065779002 10:29149392-29149414 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065778997 Original CRISPR CAAAAGCTAGCCTGGCGTGG TGG (reversed) Intergenic
No off target data available for this crispr