ID: 1065779181

View in Genome Browser
Species Human (GRCh38)
Location 10:29150970-29150992
Sequence GCTATTTTCTCCCATTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065779181_1065779185 0 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779185 10:29150993-29151015 AAAAGGCACTATAGGATGGATGG No data
1065779181_1065779187 2 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779187 10:29150995-29151017 AAGGCACTATAGGATGGATGGGG No data
1065779181_1065779188 3 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779188 10:29150996-29151018 AGGCACTATAGGATGGATGGGGG No data
1065779181_1065779186 1 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779186 10:29150994-29151016 AAAGGCACTATAGGATGGATGGG No data
1065779181_1065779183 -8 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779183 10:29150985-29151007 AAAATAGCAAAAGGCACTATAGG No data
1065779181_1065779184 -4 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779184 10:29150989-29151011 TAGCAAAAGGCACTATAGGATGG No data
1065779181_1065779189 20 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779189 10:29151013-29151035 TGGGGGTCTCAGCAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065779181 Original CRISPR GCTATTTTCTCCCATTTCTG TGG (reversed) Intergenic
No off target data available for this crispr