ID: 1065779189

View in Genome Browser
Species Human (GRCh38)
Location 10:29151013-29151035
Sequence TGGGGGTCTCAGCAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065779181_1065779189 20 Left 1065779181 10:29150970-29150992 CCACAGAAATGGGAGAAAATAGC No data
Right 1065779189 10:29151013-29151035 TGGGGGTCTCAGCAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065779189 Original CRISPR TGGGGGTCTCAGCAGAATGA AGG Intergenic
No off target data available for this crispr