ID: 1065782578

View in Genome Browser
Species Human (GRCh38)
Location 10:29183724-29183746
Sequence TGAGAGCAGCCCAATGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782578_1065782584 5 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782578_1065782583 -6 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782578_1065782586 24 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG No data
1065782578_1065782582 -7 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782582 10:29183740-29183762 GCTCTCATCACAGGGAAGAAAGG No data
1065782578_1065782587 30 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782587 10:29183777-29183799 ACACAACTCCTTTTAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782578 Original CRISPR TGAGAGCAGCCCAATGGCAA AGG (reversed) Intergenic
No off target data available for this crispr