ID: 1065782579

View in Genome Browser
Species Human (GRCh38)
Location 10:29183730-29183752
Sequence CTGTGATGAGAGCAGCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782579_1065782584 -1 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782579_1065782586 18 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG No data
1065782579_1065782588 25 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782588 10:29183778-29183800 CACAACTCCTTTTAGGCTGAGGG No data
1065782579_1065782587 24 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782587 10:29183777-29183799 ACACAACTCCTTTTAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782579 Original CRISPR CTGTGATGAGAGCAGCCCAA TGG (reversed) Intergenic
No off target data available for this crispr