ID: 1065782583

View in Genome Browser
Species Human (GRCh38)
Location 10:29183741-29183763
Sequence CTCTCATCACAGGGAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782567_1065782583 29 Left 1065782567 10:29183689-29183711 CCAGGCTTATAAACCCCTCCCCA No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782572_1065782583 10 Left 1065782572 10:29183708-29183730 CCCATCTTCCTCACTCCCTTTGC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782568_1065782583 16 Left 1065782568 10:29183702-29183724 CCCCTCCCCATCTTCCTCACTCC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782571_1065782583 11 Left 1065782571 10:29183707-29183729 CCCCATCTTCCTCACTCCCTTTG No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782578_1065782583 -6 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782569_1065782583 15 Left 1065782569 10:29183703-29183725 CCCTCCCCATCTTCCTCACTCCC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782576_1065782583 2 Left 1065782576 10:29183716-29183738 CCTCACTCCCTTTGCCATTGGGC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782577_1065782583 -5 Left 1065782577 10:29183723-29183745 CCCTTTGCCATTGGGCTGCTCTC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782570_1065782583 14 Left 1065782570 10:29183704-29183726 CCTCCCCATCTTCCTCACTCCCT No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data
1065782573_1065782583 9 Left 1065782573 10:29183709-29183731 CCATCTTCCTCACTCCCTTTGCC No data
Right 1065782583 10:29183741-29183763 CTCTCATCACAGGGAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782583 Original CRISPR CTCTCATCACAGGGAAGAAA GGG Intergenic
No off target data available for this crispr