ID: 1065782584

View in Genome Browser
Species Human (GRCh38)
Location 10:29183752-29183774
Sequence GGGAAGAAAGGGAGAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782577_1065782584 6 Left 1065782577 10:29183723-29183745 CCCTTTGCCATTGGGCTGCTCTC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782569_1065782584 26 Left 1065782569 10:29183703-29183725 CCCTCCCCATCTTCCTCACTCCC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782579_1065782584 -1 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782571_1065782584 22 Left 1065782571 10:29183707-29183729 CCCCATCTTCCTCACTCCCTTTG No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782568_1065782584 27 Left 1065782568 10:29183702-29183724 CCCCTCCCCATCTTCCTCACTCC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782578_1065782584 5 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782573_1065782584 20 Left 1065782573 10:29183709-29183731 CCATCTTCCTCACTCCCTTTGCC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782570_1065782584 25 Left 1065782570 10:29183704-29183726 CCTCCCCATCTTCCTCACTCCCT No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782572_1065782584 21 Left 1065782572 10:29183708-29183730 CCCATCTTCCTCACTCCCTTTGC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data
1065782576_1065782584 13 Left 1065782576 10:29183716-29183738 CCTCACTCCCTTTGCCATTGGGC No data
Right 1065782584 10:29183752-29183774 GGGAAGAAAGGGAGAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782584 Original CRISPR GGGAAGAAAGGGAGAAATCC TGG Intergenic
No off target data available for this crispr