ID: 1065782586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:29183771-29183793 |
Sequence | CTGGACACACAACTCCTTTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065782577_1065782586 | 25 | Left | 1065782577 | 10:29183723-29183745 | CCCTTTGCCATTGGGCTGCTCTC | No data | ||
Right | 1065782586 | 10:29183771-29183793 | CTGGACACACAACTCCTTTTAGG | No data | ||||
1065782578_1065782586 | 24 | Left | 1065782578 | 10:29183724-29183746 | CCTTTGCCATTGGGCTGCTCTCA | No data | ||
Right | 1065782586 | 10:29183771-29183793 | CTGGACACACAACTCCTTTTAGG | No data | ||||
1065782579_1065782586 | 18 | Left | 1065782579 | 10:29183730-29183752 | CCATTGGGCTGCTCTCATCACAG | No data | ||
Right | 1065782586 | 10:29183771-29183793 | CTGGACACACAACTCCTTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065782586 | Original CRISPR | CTGGACACACAACTCCTTTT AGG | Intergenic | ||