ID: 1065782586

View in Genome Browser
Species Human (GRCh38)
Location 10:29183771-29183793
Sequence CTGGACACACAACTCCTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782578_1065782586 24 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG No data
1065782579_1065782586 18 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG No data
1065782577_1065782586 25 Left 1065782577 10:29183723-29183745 CCCTTTGCCATTGGGCTGCTCTC No data
Right 1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782586 Original CRISPR CTGGACACACAACTCCTTTT AGG Intergenic
No off target data available for this crispr