ID: 1065782587

View in Genome Browser
Species Human (GRCh38)
Location 10:29183777-29183799
Sequence ACACAACTCCTTTTAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782579_1065782587 24 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782587 10:29183777-29183799 ACACAACTCCTTTTAGGCTGAGG No data
1065782578_1065782587 30 Left 1065782578 10:29183724-29183746 CCTTTGCCATTGGGCTGCTCTCA No data
Right 1065782587 10:29183777-29183799 ACACAACTCCTTTTAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782587 Original CRISPR ACACAACTCCTTTTAGGCTG AGG Intergenic
No off target data available for this crispr