ID: 1065782588

View in Genome Browser
Species Human (GRCh38)
Location 10:29183778-29183800
Sequence CACAACTCCTTTTAGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065782579_1065782588 25 Left 1065782579 10:29183730-29183752 CCATTGGGCTGCTCTCATCACAG No data
Right 1065782588 10:29183778-29183800 CACAACTCCTTTTAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065782588 Original CRISPR CACAACTCCTTTTAGGCTGA GGG Intergenic
No off target data available for this crispr