ID: 1065783455

View in Genome Browser
Species Human (GRCh38)
Location 10:29191627-29191649
Sequence ATCTGCTTGTTGCAGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065783449_1065783455 4 Left 1065783449 10:29191600-29191622 CCCTCAGTGATGTGGTCCCTGAC No data
Right 1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG No data
1065783450_1065783455 3 Left 1065783450 10:29191601-29191623 CCTCAGTGATGTGGTCCCTGACG No data
Right 1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG No data
1065783448_1065783455 10 Left 1065783448 10:29191594-29191616 CCAGGACCCTCAGTGATGTGGTC No data
Right 1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG No data
1065783447_1065783455 11 Left 1065783447 10:29191593-29191615 CCCAGGACCCTCAGTGATGTGGT No data
Right 1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065783455 Original CRISPR ATCTGCTTGTTGCAGTCAGA GGG Intergenic
No off target data available for this crispr