ID: 1065784698

View in Genome Browser
Species Human (GRCh38)
Location 10:29202406-29202428
Sequence CCTTCCTTTCAGGATTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065784686_1065784698 19 Left 1065784686 10:29202364-29202386 CCCCTCGAGGGATGCAGAGGGCC No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784683_1065784698 22 Left 1065784683 10:29202361-29202383 CCTCCCCTCGAGGGATGCAGAGG No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784690_1065784698 -3 Left 1065784690 10:29202386-29202408 CCCATGAGCTCGCTATATCCCCT No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784687_1065784698 18 Left 1065784687 10:29202365-29202387 CCCTCGAGGGATGCAGAGGGCCC No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784691_1065784698 -4 Left 1065784691 10:29202387-29202409 CCATGAGCTCGCTATATCCCCTT No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784688_1065784698 17 Left 1065784688 10:29202366-29202388 CCTCGAGGGATGCAGAGGGCCCC No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data
1065784689_1065784698 -2 Left 1065784689 10:29202385-29202407 CCCCATGAGCTCGCTATATCCCC No data
Right 1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065784698 Original CRISPR CCTTCCTTTCAGGATTTGGA GGG Intergenic
No off target data available for this crispr