ID: 1065786509

View in Genome Browser
Species Human (GRCh38)
Location 10:29220575-29220597
Sequence CTGGCTTTCTTCTGACTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065786500_1065786509 19 Left 1065786500 10:29220533-29220555 CCTGAAACACCCATGCTCCCAGA No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786499_1065786509 22 Left 1065786499 10:29220530-29220552 CCTCCTGAAACACCCATGCTCCC No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786507_1065786509 1 Left 1065786507 10:29220551-29220573 CCAGATTCTGGGACACTGGTGCT No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786498_1065786509 23 Left 1065786498 10:29220529-29220551 CCCTCCTGAAACACCCATGCTCC No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786506_1065786509 2 Left 1065786506 10:29220550-29220572 CCCAGATTCTGGGACACTGGTGC No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786504_1065786509 9 Left 1065786504 10:29220543-29220565 CCATGCTCCCAGATTCTGGGACA No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data
1065786503_1065786509 10 Left 1065786503 10:29220542-29220564 CCCATGCTCCCAGATTCTGGGAC No data
Right 1065786509 10:29220575-29220597 CTGGCTTTCTTCTGACTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065786509 Original CRISPR CTGGCTTTCTTCTGACTCGC TGG Intergenic
No off target data available for this crispr