ID: 1065787410

View in Genome Browser
Species Human (GRCh38)
Location 10:29229527-29229549
Sequence TGGCTGATCCCCTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065787401_1065787410 4 Left 1065787401 10:29229500-29229522 CCGCCTGGAGAGGAGGCTGTGGG No data
Right 1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG No data
1065787403_1065787410 1 Left 1065787403 10:29229503-29229525 CCTGGAGAGGAGGCTGTGGGAGG No data
Right 1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065787410 Original CRISPR TGGCTGATCCCCTGGGGAGG AGG Intergenic
No off target data available for this crispr