ID: 1065799840

View in Genome Browser
Species Human (GRCh38)
Location 10:29342150-29342172
Sequence CAATGTGCTGCCACTATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065799840_1065799843 5 Left 1065799840 10:29342150-29342172 CCACTGATAGTGGCAGCACATTG No data
Right 1065799843 10:29342178-29342200 ACTTGGAACACCATAGCACTAGG No data
1065799840_1065799845 7 Left 1065799840 10:29342150-29342172 CCACTGATAGTGGCAGCACATTG No data
Right 1065799845 10:29342180-29342202 TTGGAACACCATAGCACTAGGGG No data
1065799840_1065799844 6 Left 1065799840 10:29342150-29342172 CCACTGATAGTGGCAGCACATTG No data
Right 1065799844 10:29342179-29342201 CTTGGAACACCATAGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065799840 Original CRISPR CAATGTGCTGCCACTATCAG TGG (reversed) Intergenic
No off target data available for this crispr