ID: 1065801235

View in Genome Browser
Species Human (GRCh38)
Location 10:29354892-29354914
Sequence GTGATATTCTATTCATTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065801235_1065801238 2 Left 1065801235 10:29354892-29354914 CCAGACAATGAATAGAATATCAC No data
Right 1065801238 10:29354917-29354939 GTTCTCCAGAAGCTGCCTATGGG No data
1065801235_1065801237 1 Left 1065801235 10:29354892-29354914 CCAGACAATGAATAGAATATCAC No data
Right 1065801237 10:29354916-29354938 AGTTCTCCAGAAGCTGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065801235 Original CRISPR GTGATATTCTATTCATTGTC TGG (reversed) Intergenic
No off target data available for this crispr