ID: 1065801238

View in Genome Browser
Species Human (GRCh38)
Location 10:29354917-29354939
Sequence GTTCTCCAGAAGCTGCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065801234_1065801238 3 Left 1065801234 10:29354891-29354913 CCCAGACAATGAATAGAATATCA No data
Right 1065801238 10:29354917-29354939 GTTCTCCAGAAGCTGCCTATGGG No data
1065801235_1065801238 2 Left 1065801235 10:29354892-29354914 CCAGACAATGAATAGAATATCAC No data
Right 1065801238 10:29354917-29354939 GTTCTCCAGAAGCTGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065801238 Original CRISPR GTTCTCCAGAAGCTGCCTAT GGG Intergenic
No off target data available for this crispr