ID: 1065804044

View in Genome Browser
Species Human (GRCh38)
Location 10:29378630-29378652
Sequence CGGGGGGTATGAAGGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065804029_1065804044 22 Left 1065804029 10:29378585-29378607 CCGAGAGCCGCAGGCAGAAGCAG No data
Right 1065804044 10:29378630-29378652 CGGGGGGTATGAAGGGACAAAGG No data
1065804033_1065804044 15 Left 1065804033 10:29378592-29378614 CCGCAGGCAGAAGCAGGGCAGGG No data
Right 1065804044 10:29378630-29378652 CGGGGGGTATGAAGGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065804044 Original CRISPR CGGGGGGTATGAAGGGACAA AGG Intergenic
No off target data available for this crispr