ID: 1065804149

View in Genome Browser
Species Human (GRCh38)
Location 10:29379428-29379450
Sequence TTCTCGAGCACTGGGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065804145_1065804149 -7 Left 1065804145 10:29379412-29379434 CCTGTCGGTATTTCCATTCTCGA No data
Right 1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG No data
1065804142_1065804149 17 Left 1065804142 10:29379388-29379410 CCACAGTTGAGTCTTCAGATCCA No data
Right 1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG No data
1065804140_1065804149 30 Left 1065804140 10:29379375-29379397 CCATCCATATATGCCACAGTTGA No data
Right 1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG No data
1065804144_1065804149 -3 Left 1065804144 10:29379408-29379430 CCAGCCTGTCGGTATTTCCATTC No data
Right 1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG No data
1065804141_1065804149 26 Left 1065804141 10:29379379-29379401 CCATATATGCCACAGTTGAGTCT No data
Right 1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065804149 Original CRISPR TTCTCGAGCACTGGGTAATG TGG Intergenic
No off target data available for this crispr