ID: 1065804590

View in Genome Browser
Species Human (GRCh38)
Location 10:29382905-29382927
Sequence GCTTCTGCACTGAAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065804584_1065804590 6 Left 1065804584 10:29382876-29382898 CCGGGTTGGCACACCAGGGAAGG No data
Right 1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG No data
1065804576_1065804590 30 Left 1065804576 10:29382852-29382874 CCCGGGCATCTGTATCTCAGGGG No data
Right 1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG No data
1065804586_1065804590 -7 Left 1065804586 10:29382889-29382911 CCAGGGAAGGATGCCAGCTTCTG No data
Right 1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG No data
1065804578_1065804590 29 Left 1065804578 10:29382853-29382875 CCGGGCATCTGTATCTCAGGGGA No data
Right 1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065804590 Original CRISPR GCTTCTGCACTGAAGGAAAA GGG Intergenic
No off target data available for this crispr