ID: 1065806433

View in Genome Browser
Species Human (GRCh38)
Location 10:29397491-29397513
Sequence CCAAATCCACAAGATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065806433_1065806437 -8 Left 1065806433 10:29397491-29397513 CCCTGCACATCTTGTGGATTTGG No data
Right 1065806437 10:29397506-29397528 GGATTTGGTTTTTCTTTTATGGG No data
1065806433_1065806436 -9 Left 1065806433 10:29397491-29397513 CCCTGCACATCTTGTGGATTTGG No data
Right 1065806436 10:29397505-29397527 TGGATTTGGTTTTTCTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065806433 Original CRISPR CCAAATCCACAAGATGTGCA GGG (reversed) Intergenic
No off target data available for this crispr