ID: 1065806536

View in Genome Browser
Species Human (GRCh38)
Location 10:29398369-29398391
Sequence CTCAGAGCACAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065806536_1065806540 20 Left 1065806536 10:29398369-29398391 CCGTCCTCCTTCTGTGCTCTGAG No data
Right 1065806540 10:29398412-29398434 ACAGCCATAGCACCTAGCACTGG No data
1065806536_1065806543 30 Left 1065806536 10:29398369-29398391 CCGTCCTCCTTCTGTGCTCTGAG No data
Right 1065806543 10:29398422-29398444 CACCTAGCACTGGGCTTAGCAGG No data
1065806536_1065806541 21 Left 1065806536 10:29398369-29398391 CCGTCCTCCTTCTGTGCTCTGAG No data
Right 1065806541 10:29398413-29398435 CAGCCATAGCACCTAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065806536 Original CRISPR CTCAGAGCACAGAAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr