ID: 1065807216

View in Genome Browser
Species Human (GRCh38)
Location 10:29405324-29405346
Sequence ATGTCCTTCTGTAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065807214_1065807216 2 Left 1065807214 10:29405299-29405321 CCATGGAAGAAGAACCTAACAAA No data
Right 1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG No data
1065807213_1065807216 18 Left 1065807213 10:29405283-29405305 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065807216 Original CRISPR ATGTCCTTCTGTAAGAGTGA AGG Intergenic
No off target data available for this crispr