ID: 1065810002

View in Genome Browser
Species Human (GRCh38)
Location 10:29433305-29433327
Sequence GCAACAAAACTGATTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065810002_1065810006 20 Left 1065810002 10:29433305-29433327 CCTGCTTGAATCAGTTTTGTTGC No data
Right 1065810006 10:29433348-29433370 CTTCTTTGCAAATGTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065810002 Original CRISPR GCAACAAAACTGATTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr