ID: 1065811242

View in Genome Browser
Species Human (GRCh38)
Location 10:29445734-29445756
Sequence CCATTAGGACACAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065811242_1065811250 -5 Left 1065811242 10:29445734-29445756 CCATGCTCCCTGTGTCCTAATGG No data
Right 1065811250 10:29445752-29445774 AATGGGAAAGGACTCTTCTTGGG No data
1065811242_1065811249 -6 Left 1065811242 10:29445734-29445756 CCATGCTCCCTGTGTCCTAATGG No data
Right 1065811249 10:29445751-29445773 TAATGGGAAAGGACTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065811242 Original CRISPR CCATTAGGACACAGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr