ID: 1065811249

View in Genome Browser
Species Human (GRCh38)
Location 10:29445751-29445773
Sequence TAATGGGAAAGGACTCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065811242_1065811249 -6 Left 1065811242 10:29445734-29445756 CCATGCTCCCTGTGTCCTAATGG No data
Right 1065811249 10:29445751-29445773 TAATGGGAAAGGACTCTTCTTGG No data
1065811241_1065811249 9 Left 1065811241 10:29445719-29445741 CCTGAGACAGAGGGACCATGCTC No data
Right 1065811249 10:29445751-29445773 TAATGGGAAAGGACTCTTCTTGG No data
1065811238_1065811249 23 Left 1065811238 10:29445705-29445727 CCTGGAGTGTACAGCCTGAGACA No data
Right 1065811249 10:29445751-29445773 TAATGGGAAAGGACTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065811249 Original CRISPR TAATGGGAAAGGACTCTTCT TGG Intergenic
No off target data available for this crispr