ID: 1065811856 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:29450196-29450218 |
| Sequence | CTGCGCTAGCACTTCTATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065811856_1065811865 | 24 | Left | 1065811856 | 10:29450196-29450218 | CCAAGATAGAAGTGCTAGCGCAG | No data | ||
| Right | 1065811865 | 10:29450243-29450265 | CCCAGCCCTGGAAACACCCCGGG | No data | ||||
| 1065811856_1065811860 | 12 | Left | 1065811856 | 10:29450196-29450218 | CCAAGATAGAAGTGCTAGCGCAG | No data | ||
| Right | 1065811860 | 10:29450231-29450253 | TATGAAACCAGCCCCAGCCCTGG | No data | ||||
| 1065811856_1065811863 | 23 | Left | 1065811856 | 10:29450196-29450218 | CCAAGATAGAAGTGCTAGCGCAG | No data | ||
| Right | 1065811863 | 10:29450242-29450264 | CCCCAGCCCTGGAAACACCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065811856 | Original CRISPR | CTGCGCTAGCACTTCTATCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||