ID: 1065811856

View in Genome Browser
Species Human (GRCh38)
Location 10:29450196-29450218
Sequence CTGCGCTAGCACTTCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065811856_1065811865 24 Left 1065811856 10:29450196-29450218 CCAAGATAGAAGTGCTAGCGCAG No data
Right 1065811865 10:29450243-29450265 CCCAGCCCTGGAAACACCCCGGG No data
1065811856_1065811860 12 Left 1065811856 10:29450196-29450218 CCAAGATAGAAGTGCTAGCGCAG No data
Right 1065811860 10:29450231-29450253 TATGAAACCAGCCCCAGCCCTGG No data
1065811856_1065811863 23 Left 1065811856 10:29450196-29450218 CCAAGATAGAAGTGCTAGCGCAG No data
Right 1065811863 10:29450242-29450264 CCCCAGCCCTGGAAACACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065811856 Original CRISPR CTGCGCTAGCACTTCTATCT TGG (reversed) Intergenic
No off target data available for this crispr