ID: 1065813889

View in Genome Browser
Species Human (GRCh38)
Location 10:29467380-29467402
Sequence CGGGGACCAAGCCACCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065813889_1065813900 22 Left 1065813889 10:29467380-29467402 CCTGGAAGGTGGCTTGGTCCCCG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065813889 Original CRISPR CGGGGACCAAGCCACCTTCC AGG (reversed) Intronic
900631186 1:3636395-3636417 GGGAGACCAAGCCACCTTCGGGG - Intronic
903420984 1:23217593-23217615 CGGGGGCCAAGCCTTCCTCCGGG - Intergenic
905791256 1:40790982-40791004 CGGGGGCCAGGCCAGCTGCCAGG - Intronic
915732661 1:158065267-158065289 CGGGGACCCAGGCACCATTCTGG + Intronic
917450459 1:175143649-175143671 TGTGGACCAGCCCACCTTCCAGG - Intronic
918902453 1:190441877-190441899 CTGGGAGCAAACCACATTCCAGG - Intronic
920503238 1:206498744-206498766 AGGTGACTAAGCCACCTTTCTGG + Intergenic
921949793 1:220917465-220917487 AGGGGATCAATCCACCATCCAGG + Intergenic
1063374892 10:5548405-5548427 AGGGCACCTAGCAACCTTCCAGG + Intergenic
1065813889 10:29467380-29467402 CGGGGACCAAGCCACCTTCCAGG - Intronic
1067058861 10:43067590-43067612 TGGGGACCTAGGCACCCTCCTGG - Intergenic
1067527982 10:47049753-47049775 CTGGGCCCCAGCCACCTTCAGGG - Intergenic
1068454053 10:57232043-57232065 CAGGGACCTCGCCACTTTCCTGG + Intergenic
1068480687 10:57585268-57585290 TGGGGACCAAGCAAGCTCCCAGG - Intergenic
1074813894 10:117130627-117130649 CAGGGACCAAGGCAGCTTACTGG + Intronic
1075233916 10:120709582-120709604 CAGGGACCATGCCAGCCTCCTGG - Intergenic
1078740785 11:14064520-14064542 TGGGGTGCAAGCCACCTTTCAGG - Intronic
1084172977 11:67409520-67409542 CGGGGCCCAAGCCATCTTTGAGG + Exonic
1084458598 11:69283812-69283834 AGGAGAACAAGCCACCTGCCTGG - Intergenic
1084972297 11:72778555-72778577 CAGGGTCCCAGCCTCCTTCCTGG + Intronic
1085386546 11:76161270-76161292 TGGGGTCCAGGCCACCTTACAGG + Intergenic
1088752971 11:112860324-112860346 CGGGGTCCAACACACCTCCCAGG - Intergenic
1093409367 12:18845731-18845753 TGGGGACCCAGCCAGCTCCCAGG + Intergenic
1096336981 12:50764186-50764208 CGGGGGACAAGCCTCCTTCTCGG - Intronic
1100707072 12:97212494-97212516 CTGGGACAAAGCCACCCTCTTGG - Intergenic
1103195975 12:119044198-119044220 CCAGGACCCAGCCACCCTCCAGG + Intronic
1108825455 13:54407782-54407804 TGGGGACCCAGCAAGCTTCCAGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113887342 13:113667854-113667876 CCTGGGCCAAGCCCCCTTCCAGG + Exonic
1119920240 14:78439946-78439968 CAGGTGCCAGGCCACCTTCCTGG - Intronic
1122016873 14:98803752-98803774 TGGGGATCATGCCACCTTGCAGG - Intergenic
1128788797 15:70417565-70417587 AGGTGACAAAGTCACCTTCCTGG + Intergenic
1132481085 16:166451-166473 CGTGGACCCAGCCAACTTTCCGG + Exonic
1132834782 16:1947288-1947310 CTGGGCCCAGGCCACCTTCTCGG + Exonic
1132854993 16:2040758-2040780 CGGGGACAGGGCCACGTTCCTGG - Intronic
1136383982 16:29911402-29911424 CGGGAGCCAGGCCACCTCCCCGG + Intronic
1137670138 16:50273972-50273994 AGGGGACCAGGCAGCCTTCCTGG + Intronic
1143863411 17:9907327-9907349 CTGGGAGAAAGCCACCTGCCAGG + Intergenic
1146637067 17:34514397-34514419 TGGGGTCCAGGCCACCTTGCAGG - Intergenic
1147449594 17:40495943-40495965 CTGGCACCAAGCCCCCCTCCTGG + Intronic
1150295101 17:64003220-64003242 CTGGGACCATGCCACCCTCCAGG - Intronic
1152251064 17:79212814-79212836 AGGGGACCCAGACAACTTCCTGG + Intronic
1152811534 17:82384980-82385002 CGTGCACCACGCCACCTCCCGGG - Intergenic
1153674511 18:7444601-7444623 CGAAGTCCAAGCCTCCTTCCTGG - Intergenic
1159867155 18:73719779-73719801 CAGGGACCCATCCACCTCCCAGG + Intergenic
1161238729 19:3210345-3210367 CGGTGCCCAGGCCCCCTTCCTGG + Intergenic
1161716826 19:5880849-5880871 CGGGGCCCCAGCCTCCCTCCTGG - Intronic
1161911426 19:7197439-7197461 CTGGGACCCCGCCTCCTTCCGGG - Intronic
1163125855 19:15243799-15243821 TGGGGACAGGGCCACCTTCCTGG - Intronic
1163724197 19:18913265-18913287 TTGGGAGCAAGCCTCCTTCCTGG - Intronic
1165389492 19:35530133-35530155 CAGGGACAAAGCCAAATTCCTGG + Intergenic
1168714579 19:58519437-58519459 CGGCGCCCAGGCCAGCTTCCCGG + Intronic
924994114 2:341266-341288 CAGGGACCAAGTCCCTTTCCGGG + Intergenic
925607535 2:5673713-5673735 CGGGCTCCCAGCCACCTGCCTGG - Intergenic
926279999 2:11438264-11438286 CAGGAACCAAGGCCCCTTCCAGG - Intergenic
933747513 2:85581869-85581891 GGGGGACCAAGGTACCTTCTGGG - Exonic
934845025 2:97656998-97657020 CAGGGAGCCAACCACCTTCCTGG + Intronic
936986826 2:118319401-118319423 CAGGGACAAAGTCAGCTTCCAGG + Intergenic
944228451 2:197370785-197370807 CCGGGCCTTAGCCACCTTCCCGG + Intergenic
947457172 2:230265588-230265610 AGGGGACCCAGCCACCTCCCAGG + Intronic
1170857525 20:20070902-20070924 CATGGCCCAGGCCACCTTCCTGG + Exonic
1172723107 20:37014305-37014327 CTGGGTTCAAGCCACCCTCCTGG + Intronic
1173266254 20:41485265-41485287 GGGGGAACAAGTCACCTTGCTGG - Intronic
1176195466 20:63834815-63834837 AGGGGACCCAGCCCCATTCCAGG + Intergenic
1178347048 21:31838679-31838701 CAGGCACCAAGCCACCATCCAGG - Intergenic
1179826949 21:43971557-43971579 CCTGGACCCAGCCACCCTCCTGG - Intronic
1180674782 22:17579780-17579802 CCTGGCCCGAGCCACCTTCCCGG - Exonic
1180924583 22:19544778-19544800 AGGGGACACAGCCACCTACCTGG + Intergenic
1182919246 22:34064477-34064499 CGGGGACTAATCCTGCTTCCTGG - Intergenic
1183288382 22:36982237-36982259 TGGGGACCAAGCCACATGGCTGG - Intergenic
1183976966 22:41517886-41517908 CGGGCATTCAGCCACCTTCCAGG - Intronic
1184237009 22:43187753-43187775 CGGGCCCCAGGACACCTTCCGGG - Intergenic
1184490263 22:44804271-44804293 CGGCCACCGAGCCTCCTTCCTGG + Intronic
951761095 3:26148289-26148311 TGGGGACCCAGCAAGCTTCCAGG - Intergenic
953007587 3:38992701-38992723 TGGTGACCATGCCACCTTCCGGG - Intergenic
954443309 3:50533537-50533559 CGGAGACCAGGCGACCCTCCTGG + Intergenic
955037873 3:55286371-55286393 CAGGGACCCAGGCACCTTCATGG - Intergenic
955217737 3:56998365-56998387 AAGGAGCCAAGCCACCTTCCTGG - Intronic
955911681 3:63864242-63864264 CGGGGCCGCAGTCACCTTCCCGG - Intergenic
956771255 3:72527857-72527879 CGGGGACTCAGCGTCCTTCCTGG - Intergenic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
968228390 3:196990098-196990120 CCGGGACCAGTCCAACTTCCAGG + Intronic
969500889 4:7552318-7552340 AGGGGACAGAGACACCTTCCTGG - Intronic
972652069 4:41027838-41027860 GGGGGACCCATCCACCTGCCAGG - Intronic
977103813 4:92853885-92853907 CGGGTACCATGCCTGCTTCCTGG + Intronic
984266797 4:177505890-177505912 TGGGGACCCAGCAAGCTTCCAGG + Intergenic
984527646 4:180875894-180875916 TGGGGACCAAGCAAGCTCCCAGG + Intergenic
988420202 5:30996485-30996507 CAGAGACCAAGCCCCCTTTCTGG + Intergenic
989475458 5:41869362-41869384 CGGGGATAAAGCCACCCTCCTGG + Intronic
992625620 5:78633719-78633741 AGGGGACTGAGCCACCTTCAGGG + Intronic
992942369 5:81774891-81774913 CTGGAACCCAGCTACCTTCCGGG - Intergenic
997413903 5:133710540-133710562 GGGGCACAAACCCACCTTCCTGG + Intergenic
1000127719 5:158263258-158263280 AGGGGAGCAAACCACCTCCCAGG - Intergenic
1001788049 5:174430817-174430839 CTGGGATCAAGTCACCTGCCTGG - Intergenic
1002064441 5:176645059-176645081 TGGGGACCCACCCACCATCCCGG - Intronic
1002189012 5:177469287-177469309 CGGGGACCAAGGCACGTGCCAGG - Intronic
1002576115 5:180175092-180175114 CAGGGACCCAGCCGCCATCCTGG + Intronic
1003035720 6:2638907-2638929 TGGGGTCCAAGCCACCTTCAGGG - Intergenic
1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG + Exonic
1006398912 6:33804589-33804611 CGGGGAGAAAGACACCTACCTGG + Intergenic
1006430174 6:33990563-33990585 AGGGGACCCAGGCACCCTCCAGG - Intergenic
1015139319 6:129911808-129911830 GGGGGAAGAAGACACCTTCCAGG + Intergenic
1017093098 6:150779217-150779239 CGGGGACCCAGCCAGGCTCCAGG - Intronic
1019475220 7:1241222-1241244 CGGGGCCCAAGTCCGCTTCCGGG - Intergenic
1020026865 7:4905546-4905568 CGGACACCAAAGCACCTTCCTGG - Intergenic
1023926627 7:44674382-44674404 AGGGAACCAAGCCACCTTGAAGG - Intronic
1025093013 7:56078505-56078527 CTGGGACCAAGCCCCTTACCTGG - Intronic
1025193062 7:56911078-56911100 CAGGGAACAAGGCAACTTCCTGG - Intergenic
1025678882 7:63665842-63665864 CAGGGAACAAGGCAACTTCCTGG + Intergenic
1029402957 7:100356899-100356921 CTGGCACCAAGGAACCTTCCTGG + Intronic
1029784659 7:102776637-102776659 CTGGGACCAAGCCATACTCCTGG - Intronic
1032078295 7:128846413-128846435 TGTTGACCAAGCCACCCTCCAGG - Exonic
1040035950 8:42870034-42870056 CCTGCACCAAGCCTCCTTCCCGG - Exonic
1042527243 8:69775919-69775941 CTGGGCTCAAGCCATCTTCCTGG - Intronic
1044443868 8:92250859-92250881 TGGAGACCAAGCCTCCTTCCTGG + Intergenic
1049763908 8:144344029-144344051 GGGGGCCCAAGGCTCCTTCCAGG + Intergenic
1053451535 9:38197950-38197972 AAGGGACCAAGCCTGCTTCCAGG + Intergenic
1055905907 9:81292920-81292942 CGGGGACCCAGCAAGCTCCCAGG + Intergenic
1059912197 9:119056850-119056872 GGGAGACGAAGCCACCTGCCTGG - Intergenic
1061019361 9:128004166-128004188 CCGGGTCCAAGCCTCCTCCCAGG - Intergenic
1062026501 9:134343053-134343075 CTGGGTCCAAGACACCTCCCAGG - Intronic
1186545759 X:10447723-10447745 GGGAGGCCAAGCCAGCTTCCTGG - Exonic
1187681327 X:21770562-21770584 AGGGGACCCAGCCAGCTCCCAGG - Intergenic
1188512553 X:30952107-30952129 CTAAGACCAAGCCACATTCCAGG - Intronic
1192881204 X:75285439-75285461 TGGGGACCCAGCAAGCTTCCAGG + Intronic
1193467816 X:81868981-81869003 CTGGGTCCAAGCCAGCGTCCAGG + Intergenic
1201260624 Y:12155619-12155641 CTGGGCTCAAGCCATCTTCCTGG - Intergenic