ID: 1065813889

View in Genome Browser
Species Human (GRCh38)
Location 10:29467380-29467402
Sequence CGGGGACCAAGCCACCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065813889_1065813900 22 Left 1065813889 10:29467380-29467402 CCTGGAAGGTGGCTTGGTCCCCG No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065813889 Original CRISPR CGGGGACCAAGCCACCTTCC AGG (reversed) Intronic