ID: 1065813900

View in Genome Browser
Species Human (GRCh38)
Location 10:29467425-29467447
Sequence CCAGTGAGAATTTGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065813897_1065813900 2 Left 1065813897 10:29467400-29467422 CCGGGAGGCCTTGGGAGCTGATT No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813896_1065813900 3 Left 1065813896 10:29467399-29467421 CCCGGGAGGCCTTGGGAGCTGAT No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813888_1065813900 23 Left 1065813888 10:29467379-29467401 CCCTGGAAGGTGGCTTGGTCCCC No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813895_1065813900 4 Left 1065813895 10:29467398-29467420 CCCCGGGAGGCCTTGGGAGCTGA No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813889_1065813900 22 Left 1065813889 10:29467380-29467402 CCTGGAAGGTGGCTTGGTCCCCG No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813886_1065813900 30 Left 1065813886 10:29467372-29467394 CCTAAGACCCTGGAAGGTGGCTT No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data
1065813898_1065813900 -6 Left 1065813898 10:29467408-29467430 CCTTGGGAGCTGATTTGCCAGTG No data
Right 1065813900 10:29467425-29467447 CCAGTGAGAATTTGAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065813900 Original CRISPR CCAGTGAGAATTTGAAGTCC TGG Intronic