ID: 1065815090

View in Genome Browser
Species Human (GRCh38)
Location 10:29475898-29475920
Sequence TTTAAGTTCTTAAAAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065815082_1065815090 29 Left 1065815082 10:29475846-29475868 CCATTTCCAACATTGCAACTGTA 0: 1
1: 1
2: 0
3: 11
4: 176
Right 1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG No data
1065815081_1065815090 30 Left 1065815081 10:29475845-29475867 CCCATTTCCAACATTGCAACTGT 0: 1
1: 1
2: 0
3: 14
4: 220
Right 1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG No data
1065815083_1065815090 23 Left 1065815083 10:29475852-29475874 CCAACATTGCAACTGTATTGAGG 0: 1
1: 1
2: 1
3: 7
4: 86
Right 1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065815090 Original CRISPR TTTAAGTTCTTAAAAGGTAG GGG Intronic
No off target data available for this crispr