ID: 1065820858

View in Genome Browser
Species Human (GRCh38)
Location 10:29523939-29523961
Sequence ACGGTTGCTCCAATGTATGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065820858_1065820864 22 Left 1065820858 10:29523939-29523961 CCGGCATACATTGGAGCAACCGT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1065820864 10:29523984-29524006 GTGTTCACGGCAGGTGAGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1065820858_1065820863 13 Left 1065820858 10:29523939-29523961 CCGGCATACATTGGAGCAACCGT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 71
1065820858_1065820862 9 Left 1065820858 10:29523939-29523961 CCGGCATACATTGGAGCAACCGT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1065820862 10:29523971-29523993 GGTAGACACTGATGTGTTCACGG 0: 1
1: 0
2: 1
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065820858 Original CRISPR ACGGTTGCTCCAATGTATGC CGG (reversed) Exonic
911567123 1:99475395-99475417 ACATTTGCTCAAATGTAAGCGGG + Intergenic
917456974 1:175193416-175193438 CCGGTTGCTCCAAGGGGTGCAGG + Intergenic
917839481 1:178966047-178966069 AAAGTTGCTTCAATGTCTGCCGG + Intergenic
917976291 1:180241082-180241104 ACTGTTGCTGTAATGTATCCAGG - Intronic
1065820858 10:29523939-29523961 ACGGTTGCTCCAATGTATGCCGG - Exonic
1067254128 10:44618686-44618708 AAGGCTGCTCCATTGTAAGCTGG - Intergenic
1070565199 10:77598760-77598782 ACGCTTGCTGCACTGGATGCGGG - Intronic
1076449474 10:130546857-130546879 AAGGAAGCTCCAATGTCTGCAGG - Intergenic
1080695546 11:34600417-34600439 GTGGTTGCTCCAACGTATGGGGG + Intergenic
1081097802 11:38961785-38961807 TCGGTTGCTTCTATGTAGGCTGG + Intergenic
1087984988 11:104667216-104667238 ACCTTTGCTCCAATGTATAATGG + Intergenic
1102840705 12:116117371-116117393 GCGTTTGCACAAATGTATGCAGG - Intronic
1130402446 15:83570170-83570192 ACTGTAGCTCCAATAAATGCAGG - Intronic
1137614144 16:49837027-49837049 ACAGTTGCTCCAATGTGTCCCGG - Intronic
1138014412 16:53415733-53415755 ACGGTTGCTCCAAGGGAAGGGGG - Intergenic
1153994737 18:10430842-10430864 AACGTTGCTCCAATGTATTTTGG - Intergenic
1164991586 19:32688437-32688459 AGGGTTGCTTCAATGTCTTCAGG - Intergenic
1168445110 19:56404753-56404775 ACCGTTGCCCCGGTGTATGCGGG + Intronic
945686093 2:212972097-212972119 AAGTTTGGTACAATGTATGCAGG + Intergenic
948651899 2:239451378-239451400 ATGGTTGCAACAATGTATGGAGG - Intergenic
1174512953 20:51068961-51068983 ACGGTTGCTAAAATTAATGCTGG + Intergenic
976088168 4:81427643-81427665 CCGGGTGCTCCAATGACTGCAGG + Exonic
978948530 4:114527926-114527948 TGGGTTGCTCCAAAGTAAGCTGG + Intergenic
987931310 5:24402414-24402436 ACGGTTACTCCATTTTATTCTGG - Intergenic
1034431850 7:151045162-151045184 ATGGTTGCTCCAAGGCATGCAGG - Intronic
1037046414 8:14310050-14310072 TCTGTTGTTCCATTGTATGCAGG + Intronic
1041230286 8:55743563-55743585 CCATTTGCTCCAATGTATGGAGG - Intronic
1191859009 X:65650611-65650633 CTGGGTGCTACAATGTATGCTGG + Intronic
1194448358 X:94013459-94013481 TCAGTTGCTCCAATGAATGTTGG + Intergenic
1197495368 X:127173100-127173122 TCGGTTGCTCCTATGTTTGCTGG + Intergenic
1202083864 Y:21114620-21114642 ACAGTTGCTTCAATAAATGCAGG - Intergenic