ID: 1065820861

View in Genome Browser
Species Human (GRCh38)
Location 10:29523958-29523980
Sequence AGTGTCTACCGTAGCATCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065820861_1065820864 3 Left 1065820861 10:29523958-29523980 CCGTGGATGCTACGGTAGACACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1065820864 10:29523984-29524006 GTGTTCACGGCAGGTGAGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1065820861_1065820863 -6 Left 1065820861 10:29523958-29523980 CCGTGGATGCTACGGTAGACACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 71
1065820861_1065820862 -10 Left 1065820861 10:29523958-29523980 CCGTGGATGCTACGGTAGACACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1065820862 10:29523971-29523993 GGTAGACACTGATGTGTTCACGG 0: 1
1: 0
2: 1
3: 14
4: 146
1065820861_1065820865 28 Left 1065820861 10:29523958-29523980 CCGTGGATGCTACGGTAGACACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1065820865 10:29524009-29524031 TGAGCTTTCCACTCTGCACCTGG 0: 1
1: 0
2: 3
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065820861 Original CRISPR AGTGTCTACCGTAGCATCCA CGG (reversed) Exonic
900757156 1:4444113-4444135 AATTTCTACCGTAGAATTCAAGG + Intergenic
904634302 1:31867789-31867811 ACCCTCTTCCGTAGCATCCATGG + Intergenic
1065820861 10:29523958-29523980 AGTGTCTACCGTAGCATCCACGG - Exonic
1065989807 10:30997505-30997527 AGTGTCTGCCGTATCTTCCAAGG - Intronic
1074445336 10:113516856-113516878 AGGGTCTGCGGTAGCATCCTTGG + Intergenic
1099021689 12:77413613-77413635 AGTGTCTACCATATCAGACAGGG + Intergenic
1109255512 13:60075873-60075895 AGTGTTGACCGTATCTTCCATGG + Intronic
1112222188 13:97502184-97502206 AGTGTCCCCAGGAGCATCCATGG - Intergenic
1112976929 13:105331785-105331807 TGTGCCTACCTTGGCATCCAGGG - Intergenic
1113606640 13:111612576-111612598 AGTGACTGCTGTAGCTTCCATGG - Intronic
1118086160 14:62419762-62419784 CATGTCTGCAGTAGCATCCAGGG - Intergenic
1126895154 15:53249618-53249640 AGTGTCTACCCTATCTTTCAGGG + Intergenic
1127528546 15:59818431-59818453 AGTGTTTTGCTTAGCATCCAGGG + Intergenic
1143593622 17:7900980-7901002 TGTATCTACCATAGCAGCCACGG - Exonic
1144117756 17:12116362-12116384 AAAGTCTACAGTAGCATCCTAGG - Intronic
1160291261 18:77596063-77596085 AGTATCTACCTTAGCAGCTAAGG - Intergenic
1160304293 18:77717571-77717593 GGTGTCTGCCTCAGCATCCACGG - Intergenic
1164911789 19:32018640-32018662 AGTGGCAACCATAGCAGCCATGG + Intergenic
1166038621 19:40188748-40188770 AGTGTCTTCCTTTGGATCCACGG + Intergenic
932062843 2:68526221-68526243 AGAGTCTACCATTTCATCCAAGG + Exonic
935253892 2:101290965-101290987 AGTCTCTACCCCAGCATCCTGGG - Intronic
945291087 2:208128230-208128252 AGAGCCTGCCTTAGCATCCATGG + Exonic
946441373 2:219699517-219699539 ATTGTCTACAGTGGCATCCTTGG + Intergenic
1176701382 21:10055557-10055579 AGTGACCACAGTAGCATGCATGG - Intergenic
1180161303 21:45999764-45999786 AGCGTCTACAGGAGCACCCATGG - Intronic
1185041694 22:48507571-48507593 AGTTGCTTCCGTGGCATCCAGGG + Intronic
950212031 3:11130798-11130820 TGTTTCTACCGTGCCATCCAAGG + Intergenic
955840019 3:63102718-63102740 AGTTTCTACCCTAGCATGAAAGG + Intergenic
961915912 3:130375086-130375108 AGTATCTACCTTAGCAGTCATGG - Intronic
964367730 3:155967627-155967649 AGAGTCTACAGTGGCCTCCAAGG + Intergenic
972035654 4:34515840-34515862 ACTGTCTACCATAGCACCTATGG + Intergenic
983335371 4:166384881-166384903 AGTGTCTATCATATCATCCCTGG - Intergenic
986611696 5:9574631-9574653 AGGGTCTACTATAGCACCCAGGG - Intergenic
989327055 5:40210564-40210586 AGAGTTTACAGTAGAATCCAGGG + Intergenic
1000346836 5:160321464-160321486 AGGGGCTTCCGTAGCTTCCAGGG + Intronic
1013715332 6:112954334-112954356 AGTTTCTTCCGTAGGATTCATGG + Intergenic
1018623185 6:165751319-165751341 AGTGTCTACAGTGGCTTCCCTGG + Intronic
1019282230 7:206296-206318 AGTGTCCACCGTTGGCTCCAGGG + Intronic
1035536792 8:397631-397653 TTTGTCTACCGTTGCGTCCAAGG - Intergenic
1045316038 8:101044539-101044561 AGTGCCTGCCGTGGCAGCCACGG + Intergenic
1047954418 8:129962500-129962522 AGTGTCTAGCCCAGCATCTATGG + Intronic
1050765187 9:9124195-9124217 AATGTCTACTGTTGCATCAAAGG - Intronic
1053767557 9:41423092-41423114 AGTGACCACAGTAGCATGCATGG + Intergenic
1054319321 9:63638643-63638665 AGTGACCACAGTAGCATGCATGG - Intergenic
1057410327 9:94811865-94811887 AGTGTCTCCCGTACCCTCAAAGG + Intronic
1060505862 9:124198040-124198062 AGTGTGTAGCGCAGCATTCAAGG - Intergenic
1062479446 9:136744614-136744636 AGTGTCCACCGGAGCAGCCTCGG - Intronic
1202786399 9_KI270719v1_random:25640-25662 AGTGACCACAGTAGCATGCATGG - Intergenic
1186387883 X:9128259-9128281 AGAGTCTACCGAAGCCTCTACGG - Intronic
1186398065 X:9230426-9230448 AGAGTCTTCAGTAGCATCCCTGG + Intergenic
1198502551 X:137266387-137266409 AGTGTCTACCATACCAGCCAAGG - Intergenic