ID: 1065820863

View in Genome Browser
Species Human (GRCh38)
Location 10:29523975-29523997
Sequence GACACTGATGTGTTCACGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065820858_1065820863 13 Left 1065820858 10:29523939-29523961 CCGGCATACATTGGAGCAACCGT 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 71
1065820861_1065820863 -6 Left 1065820861 10:29523958-29523980 CCGTGGATGCTACGGTAGACACT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065820863 Original CRISPR GACACTGATGTGTTCACGGC AGG Exonic
907751873 1:57270701-57270723 GACACTCCTGTGTTCATTGCAGG - Intronic
912654712 1:111476059-111476081 GACACTGGTGAGTTTACGACAGG + Exonic
916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG + Intergenic
920357086 1:205381853-205381875 GCCACTGATGTTTTCACAGGTGG - Exonic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924421779 1:243916824-243916846 AACATAGATGTGTTTACGGCAGG + Intergenic
1064270125 10:13857962-13857984 GACACTGATGTGTTCTTAGTTGG + Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG + Intronic
1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG + Intronic
1081783722 11:45731784-45731806 GACACTGATGTATTCTCTGAAGG - Intergenic
1083066594 11:59930345-59930367 GACTTGGATGTGTTCTCGGCAGG - Intergenic
1093636670 12:21479246-21479268 GACACTGTTATGTACAAGGCAGG + Intronic
1093910135 12:24737846-24737868 CACACTCATTTGTGCACGGCAGG + Intergenic
1094486403 12:30928808-30928830 AACAATGATGTGATCATGGCTGG - Intronic
1098448032 12:70587688-70587710 GACACTGATGTGTTCATGGAAGG + Intronic
1104137483 12:125954218-125954240 GACACTGATGTGGTCCCTGGTGG + Intergenic
1104717693 12:131026814-131026836 GATATTGCAGTGTTCACGGCTGG + Intronic
1107875684 13:44788909-44788931 GGCACTGATGTGGTCTGGGCCGG - Intergenic
1108920112 13:55662402-55662424 GACACTGCTCTGTTCATGGTGGG - Intergenic
1109569280 13:64164700-64164722 GGTACTGATGGGTGCACGGCTGG + Intergenic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1120093497 14:80361520-80361542 GTCAATAATGTGTTCACGTCAGG - Intronic
1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG + Intergenic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1130959563 15:88650692-88650714 GATAGTGATGTGTCCAAGGCAGG - Intronic
1135355042 16:21762044-21762066 GTCACTGATGTGATCCTGGCGGG + Intergenic
1135453526 16:22578186-22578208 GTCACTGATGTGATCCTGGCGGG + Intergenic
1136564150 16:31060107-31060129 TAAACAGATGTGTTCACTGCTGG + Intergenic
1137496267 16:48971598-48971620 GACACTGCTGTGATCAGGGCTGG - Intergenic
1141033384 16:80608559-80608581 GCCAATGATGTCATCACGGCTGG - Intronic
1143376325 17:6469690-6469712 GAGGCTGCTGTTTTCACGGCAGG - Intronic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1144957456 17:19026225-19026247 GATAAAGATGTGTTCAAGGCCGG + Intronic
1144977700 17:19148291-19148313 GATAAAGATGTGTTCAAGGCCGG - Intronic
1156358803 18:36365732-36365754 GACACTGAGCTGGTGACGGCCGG + Intronic
1160198357 18:76776144-76776166 AACACTGAGCTGTTCACGTCAGG - Intergenic
1163075357 19:14886204-14886226 GAAACTGATGTGTTCAGAGTTGG - Intergenic
1164538761 19:29106582-29106604 GACACAGGTGTGTTCAGGGGCGG - Intergenic
938184169 2:129213515-129213537 GACACTGATATGTTCTGGGATGG - Intergenic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1170095241 20:12638916-12638938 GACTCTAATGTGATCACTGCTGG + Intergenic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1174174482 20:48636274-48636296 GACTCTGTTTTGTTCACTGCTGG + Intronic
1180947589 22:19705223-19705245 GACACTCACCTGTCCACGGCGGG - Intergenic
965148768 3:164942755-164942777 CACACTGATTTGTTCAAGGATGG + Intergenic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
986236063 5:5911885-5911907 GACAGTGATTTGTTCACACCGGG + Intergenic
998907825 5:146925595-146925617 GACAATGATGTGTTCAAGTGTGG + Intronic
999438217 5:151580990-151581012 GAGACTGATGGGCTCACGGAAGG - Intergenic
1000949622 5:167464998-167465020 GACATTGATGTGTTTACCGTGGG + Intronic
1001544391 5:172561710-172561732 GTTACTTATGTGTTCAGGGCTGG + Intergenic
1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG + Intergenic
1003823980 6:9931908-9931930 GGCACAGATGTGTTCTCGGCTGG - Intronic
1006801544 6:36763052-36763074 GAAACGGATGTGTGCAAGGCTGG - Intronic
1006928245 6:37671272-37671294 TACACAGATGTGTTTACTGCAGG - Intronic
1007707941 6:43802679-43802701 AACACTGATATGTTCAAGGAAGG - Intergenic
1008656387 6:53618363-53618385 GAAAGTGATGTGTTCACAGGTGG - Intergenic
1022045542 7:26619684-26619706 GACTCTGAAGTGTTTATGGCGGG - Intergenic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1029626686 7:101724367-101724389 GACCCTGATGTGCTCACCTCAGG + Intergenic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1031428806 7:121639910-121639932 GACAGTGCTGTGTACACAGCGGG - Intergenic
1033301257 7:140188259-140188281 GACACTGATGTCTCCAAGACAGG + Intergenic
1035672596 8:1431788-1431810 GACACTGATGCGTGCATGACAGG + Intergenic
1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG + Intronic
1055431142 9:76245440-76245462 GGCACTGAAGTGTTCAAGGAAGG + Intronic
1055994106 9:82139007-82139029 GACAGTGATGTTCTCAGGGCAGG + Intergenic
1057171226 9:92964457-92964479 GAGACGGATGTTTTCAAGGCAGG + Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1185700412 X:2227197-2227219 GACACTGAGTTGTTCCCAGCAGG - Intronic
1195647374 X:107247476-107247498 GACACTGACATGTTCCAGGCAGG + Intergenic
1197880298 X:131159351-131159373 AACACTGATGTGTTGAAGGGAGG + Intergenic
1201548712 Y:15195807-15195829 GACAATGATGTGTTAAAGGGAGG - Intergenic
1202600345 Y:26587813-26587835 GTCACTGAGGTGTTGAGGGCTGG + Intergenic