ID: 1065822710

View in Genome Browser
Species Human (GRCh38)
Location 10:29540618-29540640
Sequence CTGGAAAATGGCTGCTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065822704_1065822710 8 Left 1065822704 10:29540587-29540609 CCAGCCTTCCAGAGTGACAAGCT 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822705_1065822710 4 Left 1065822705 10:29540591-29540613 CCTTCCAGAGTGACAAGCTTCCA 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822703_1065822710 12 Left 1065822703 10:29540583-29540605 CCTTCCAGCCTTCCAGAGTGACA 0: 1
1: 0
2: 0
3: 19
4: 288
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822702_1065822710 16 Left 1065822702 10:29540579-29540601 CCTTCCTTCCAGCCTTCCAGAGT No data
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822700_1065822710 27 Left 1065822700 10:29540568-29540590 CCCAGCATGCACCTTCCTTCCAG 0: 1
1: 5
2: 2
3: 26
4: 309
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822698_1065822710 29 Left 1065822698 10:29540566-29540588 CCCCCAGCATGCACCTTCCTTCC 0: 1
1: 1
2: 4
3: 34
4: 396
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822701_1065822710 26 Left 1065822701 10:29540569-29540591 CCAGCATGCACCTTCCTTCCAGC 0: 1
1: 5
2: 3
3: 44
4: 341
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822697_1065822710 30 Left 1065822697 10:29540565-29540587 CCCCCCAGCATGCACCTTCCTTC 0: 1
1: 0
2: 4
3: 96
4: 512
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822706_1065822710 0 Left 1065822706 10:29540595-29540617 CCAGAGTGACAAGCTTCCACATT 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data
1065822699_1065822710 28 Left 1065822699 10:29540567-29540589 CCCCAGCATGCACCTTCCTTCCA 0: 1
1: 0
2: 1
3: 31
4: 341
Right 1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065822710 Original CRISPR CTGGAAAATGGCTGCTTCCT TGG Intronic
No off target data available for this crispr