ID: 1065825456

View in Genome Browser
Species Human (GRCh38)
Location 10:29566718-29566740
Sequence CTGAGTCAGAAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065825456_1065825464 4 Left 1065825456 10:29566718-29566740 CCTCTCTGCTTCTTCTGACTCAG No data
Right 1065825464 10:29566745-29566767 CCCCCAGCGGGAGACTGGTAGGG No data
1065825456_1065825460 -1 Left 1065825456 10:29566718-29566740 CCTCTCTGCTTCTTCTGACTCAG No data
Right 1065825460 10:29566740-29566762 GAGGCCCCCCAGCGGGAGACTGG No data
1065825456_1065825459 -8 Left 1065825456 10:29566718-29566740 CCTCTCTGCTTCTTCTGACTCAG No data
Right 1065825459 10:29566733-29566755 TGACTCAGAGGCCCCCCAGCGGG No data
1065825456_1065825458 -9 Left 1065825456 10:29566718-29566740 CCTCTCTGCTTCTTCTGACTCAG No data
Right 1065825458 10:29566732-29566754 CTGACTCAGAGGCCCCCCAGCGG No data
1065825456_1065825462 3 Left 1065825456 10:29566718-29566740 CCTCTCTGCTTCTTCTGACTCAG No data
Right 1065825462 10:29566744-29566766 CCCCCCAGCGGGAGACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065825456 Original CRISPR CTGAGTCAGAAGAAGCAGAG AGG (reversed) Intronic
No off target data available for this crispr