ID: 1065827616

View in Genome Browser
Species Human (GRCh38)
Location 10:29586210-29586232
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065827609_1065827616 28 Left 1065827609 10:29586159-29586181 CCACACACACTCATTAAACAGCT 0: 1
1: 0
2: 2
3: 25
4: 253
Right 1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr