ID: 1065830394

View in Genome Browser
Species Human (GRCh38)
Location 10:29609350-29609372
Sequence CAGCACCAGCAGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 2, 2: 9, 3: 71, 4: 530}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065830394_1065830407 12 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830407 10:29609385-29609407 ACATGATGGGAAACAGCAGTGGG No data
1065830394_1065830401 -1 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830401 10:29609372-29609394 GAGTGGCCACCCCACATGATGGG No data
1065830394_1065830409 17 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830409 10:29609390-29609412 ATGGGAAACAGCAGTGGGGCTGG No data
1065830394_1065830408 13 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830408 10:29609386-29609408 CATGATGGGAAACAGCAGTGGGG No data
1065830394_1065830406 11 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830406 10:29609384-29609406 CACATGATGGGAAACAGCAGTGG No data
1065830394_1065830400 -2 Left 1065830394 10:29609350-29609372 CCTCCCACCCTCTGCTGGTGCTG 0: 1
1: 2
2: 9
3: 71
4: 530
Right 1065830400 10:29609371-29609393 TGAGTGGCCACCCCACATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065830394 Original CRISPR CAGCACCAGCAGAGGGTGGG AGG (reversed) Intronic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
900988854 1:6088771-6088793 GGGCAGCAGCAGGGGGTGGGGGG - Intronic
901377440 1:8849334-8849356 CTGCACCTGCAGAAGGTTGGGGG + Intergenic
901519055 1:9768874-9768896 AAGCAACAGAAGAGGGAGGGAGG + Intronic
901865847 1:12106272-12106294 CAGCACGTGCAGAGGGCGGGTGG - Intronic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
902370632 1:16004739-16004761 CAAGACCAGCTGGGGGTGGGTGG + Intronic
902703456 1:18188935-18188957 CTGCAGCAGCAGAGGGTTTGTGG - Intronic
902772277 1:18652167-18652189 CAGAGCCGGTAGAGGGTGGGAGG + Intronic
902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG + Intergenic
903544692 1:24116639-24116661 CAGCACCAGCAGGGGAGGTGGGG + Intergenic
903943136 1:26945360-26945382 GAGAACAACCAGAGGGTGGGAGG - Intronic
904294203 1:29507209-29507231 CACCACCTGCAGAGGGTGAGGGG - Intergenic
904906257 1:33899390-33899412 CAGAAAGAGCAGAGGTTGGGAGG + Intronic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905393052 1:37650512-37650534 AGGCACCAGCAGTGGGAGGGAGG + Intergenic
905656425 1:39688959-39688981 CAGCACCAGGTGAGGGTCAGAGG - Intronic
906492278 1:46278108-46278130 CAGAACCATCAGGGGGTGGCCGG - Exonic
907834781 1:58098491-58098513 GAGCATCAGCAGAGGGTTGGAGG - Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
912538749 1:110396548-110396570 CAGCAGCTGCGGAGGGTGCGCGG - Intergenic
912572854 1:110637370-110637392 CAGCCCTAGCTGATGGTGGGTGG + Intergenic
914325505 1:146611540-146611562 AGGCACCAGCAGATGGTGGAAGG + Intergenic
915313587 1:155016478-155016500 CAGCAGCGGTAGAGGGTGGTGGG - Exonic
915570301 1:156741685-156741707 CATCACCAGCTAAGGGTGGCAGG + Intergenic
915980068 1:160415025-160415047 CAGCCCCAGGTGAGGGTGAGGGG - Intronic
916015980 1:160750287-160750309 CAGCACCTTCAGAGAATGGGTGG - Exonic
916103264 1:161411077-161411099 CAGCACTTTGAGAGGGTGGGTGG - Intergenic
916395787 1:164386023-164386045 CAGGGCCTGCAGGGGGTGGGGGG - Intergenic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
917479232 1:175396660-175396682 CAGCTCCAGCAGCGGGTGCCTGG - Exonic
917556134 1:176090556-176090578 CAGCAGCAGCACAGGGCAGGGGG + Intronic
917925122 1:179782840-179782862 CGGCACCAGCCAGGGGTGGGAGG - Intronic
918942974 1:191026209-191026231 CAGCAGCTGCAGAGGGGGCGCGG - Intergenic
919132116 1:193464618-193464640 CAGTACCAGAAGGGGGTGGGAGG - Intergenic
919770446 1:201155004-201155026 CAGCACCAGCATGGGGTAGGGGG - Intronic
919805802 1:201380451-201380473 CAGCACTAGCAGTGGGTGGGAGG + Intronic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921933016 1:220770710-220770732 GACCAACAGCAGAGGCTGGGAGG - Intronic
922032592 1:221816532-221816554 CAGCAGCAGCAGGGTGTGAGAGG + Intergenic
922565744 1:226600643-226600665 CTGCAGCAGCACAGAGTGGGAGG - Intronic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923540731 1:234886273-234886295 CAGCCCCAGCTCAGGGTGGGTGG + Intergenic
923680501 1:236114626-236114648 GAGCACCTCCTGAGGGTGGGGGG + Intergenic
923936435 1:238765339-238765361 CAGCAAAAGCTGGGGGTGGGGGG + Intergenic
1063158516 10:3401710-3401732 GAGCTCCATAAGAGGGTGGGAGG + Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1065856842 10:29838171-29838193 AAGCAGCAGCACAGGGTAGGGGG + Intergenic
1067063216 10:43088867-43088889 CAGCAACAGCACAGGGCCGGAGG - Intronic
1067440535 10:46306955-46306977 CTGTCCCAGCAGGGGGTGGGGGG - Intronic
1067806791 10:49398161-49398183 CCGCAGCAGCCGGGGGTGGGTGG - Intergenic
1068596169 10:58905170-58905192 TAGCCCCAGCAGAGGGTGGCAGG - Intergenic
1069160227 10:65083908-65083930 CAGCACCGGCAGAGGGTGGTAGG + Intergenic
1069806438 10:71128020-71128042 CAGCATCAGCACAGGATGAGGGG - Intergenic
1069867810 10:71514474-71514496 CAGGAACAGCAGGGAGTGGGAGG + Intronic
1070783756 10:79151560-79151582 CAGCACCAGCTGGGCTTGGGAGG + Intronic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071490355 10:86132005-86132027 CAGCACAAGCAGTGGGTGCAGGG + Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072518724 10:96211581-96211603 GAGCAACAGCAAAGAGTGGGTGG + Intronic
1072802600 10:98403516-98403538 GAGCACCAGATGGGGGTGGGAGG - Intronic
1073554587 10:104436550-104436572 CAGGAACAGGAGAGAGTGGGAGG + Intronic
1073989433 10:109245713-109245735 CGGCACCAGCTGAGGCTGTGTGG - Intergenic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075723887 10:124602025-124602047 CAGCTCCATCCGGGGGTGGGTGG + Intronic
1075936122 10:126342943-126342965 CAGGACCAGCAGAGAGGAGGAGG - Intronic
1076250179 10:128979003-128979025 CAGCACAGGCAATGGGTGGGGGG - Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076677803 10:132156494-132156516 CAGCAGCAGCGAAGGCTGGGTGG - Intronic
1076778278 10:132709998-132710020 CAGCATCAGCTGAGGCTGAGGGG + Intronic
1076812990 10:132898818-132898840 CAGCACCAGCCGAGGAGGGGAGG - Intronic
1077104756 11:837340-837362 CAGCTGCAGCAGGAGGTGGGTGG + Exonic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077401467 11:2360190-2360212 CAGCTCCAGCACAAGCTGGGTGG + Intergenic
1077411969 11:2407872-2407894 CTCCAGCAGCAGTGGGTGGGTGG + Exonic
1077755641 11:5025047-5025069 CAGCACTAGCATAGGGTGGCTGG - Intergenic
1078053040 11:7984057-7984079 CGGCAGCATCAGAGGGTGGGCGG + Intronic
1078607074 11:12786120-12786142 CAGTCACAGCACAGGGTGGGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080405646 11:31976471-31976493 CAGCACTTTCAGAGGGTGAGTGG + Intronic
1081745676 11:45470878-45470900 CAAGACCAGCAGGGGGTGAGAGG - Intergenic
1082785304 11:57313354-57313376 CAGGACCAGGAGAAGCTGGGGGG - Exonic
1083261141 11:61523796-61523818 CTTCTCCAGCAGAGGATGGGCGG - Intronic
1083486811 11:62988350-62988372 CAGAACCAACAACGGGTGGGAGG - Intergenic
1083665474 11:64271798-64271820 CAGCGCCTGCAGAGGGTCAGTGG + Exonic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1084175837 11:67421623-67421645 CAGGACCCGCAGAGGGTGCTGGG + Intronic
1084321403 11:68375438-68375460 CAGCACGAGCAGGGGCAGGGAGG - Intronic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1084534374 11:69748076-69748098 CAGCTGCAGCAGCGGGTGGGTGG - Intergenic
1084942410 11:72620066-72620088 GAGCTCCAGCAGAGGTGGGGTGG - Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1085434791 11:76491084-76491106 CAGCACCTGCACAGGGGAGGAGG - Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1087307874 11:96505756-96505778 CTGCACCAGCAGAGAGGGGCAGG - Intronic
1088816829 11:113427046-113427068 CATCAGCAGCAGGGAGTGGGGGG - Intronic
1088858962 11:113781970-113781992 CAGCACCAGCTTGGGGAGGGCGG - Intergenic
1089100702 11:115959754-115959776 CAGCACCAGCTGGAGGAGGGGGG - Intergenic
1089254572 11:117187548-117187570 GAGCATCTGCAGAGGGTGTGGGG - Intronic
1089519473 11:119054347-119054369 CAGCTCCAACAGGGGCTGGGAGG + Intronic
1090116522 11:123979489-123979511 CAGCACTGGCAGAGGGTGGGAGG + Intergenic
1090628679 11:128627521-128627543 CAGCGCCAGGTCAGGGTGGGCGG - Intergenic
1090905939 11:131074514-131074536 CAGCTCCAGGAGAGGTTGGTGGG + Intergenic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1092999345 12:13980813-13980835 CAGCACAAGCCCGGGGTGGGAGG - Intergenic
1094498550 12:31004405-31004427 CGACATCAGCAGTGGGTGGGTGG - Intergenic
1095557384 12:43523449-43523471 CAGAACCAGGTGGGGGTGGGGGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096799631 12:54101577-54101599 AATTAGCAGCAGAGGGTGGGTGG + Intergenic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097234827 12:57532247-57532269 CTGCACCAGCTCAGGGAGGGTGG + Exonic
1097515097 12:60594594-60594616 CAGCACTAGCAGAAGGCAGGAGG + Intergenic
1098299874 12:69043192-69043214 CAGCAGGTGGAGAGGGTGGGAGG + Intergenic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100697597 12:97112260-97112282 TAGCAACAGGAGAGGGTGTGCGG + Intergenic
1100978163 12:100143091-100143113 GAACACCAGCAGAGGGAAGGAGG - Intergenic
1101055055 12:100903967-100903989 CAGCAGGAGCAAAGGTTGGGAGG - Intronic
1102742797 12:115223040-115223062 CAGAGTCAGCAGACGGTGGGTGG + Intergenic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1104008874 12:124914986-124915008 CTGCACCGGGAGCGGGTGGGCGG + Exonic
1104990449 12:132621350-132621372 CTGCACCTGCTGGGGGTGGGTGG + Intronic
1106134179 13:26961959-26961981 AGGAACCAACAGAGGGTGGGAGG - Intergenic
1106202268 13:27549365-27549387 CATCACCAGCAGAGAGGAGGTGG - Intronic
1106614083 13:31310538-31310560 CAGCACCAGCAAAGGGTGGGAGG - Intronic
1108805950 13:54156654-54156676 CAGCTCCAGCAGAGAGGGAGAGG - Intergenic
1109851846 13:68075750-68075772 CAGTGCCAGTAGAGGGTGAGAGG - Intergenic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1113350622 13:109525533-109525555 GAGCACCAGCAAGGGGTTGGTGG - Intergenic
1113377897 13:109782132-109782154 CAGCACCGGCGGCGGGTGCGGGG - Exonic
1114532248 14:23403309-23403331 CAGGGACAGCAGTGGGTGGGGGG + Intronic
1114644866 14:24249727-24249749 CAGCACAGGCAGCTGGTGGGTGG - Intronic
1114992275 14:28301298-28301320 CGGCACCAGCAGGAGGTGGAAGG - Intergenic
1115398280 14:32933456-32933478 CCGCACCAGCAAAGGGGGCGAGG + Intergenic
1118847002 14:69555011-69555033 CACCTCCAGCTGAGGGTGGCTGG - Intergenic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1121639549 14:95475929-95475951 GAGCACCAGGGGAGGGTTGGTGG - Intergenic
1122229429 14:100298253-100298275 AACCACAAGCGGAGGGTGGGGGG + Intronic
1122346102 14:101061557-101061579 CAGCATCCTCAGAGGGTGGGTGG - Intergenic
1122348424 14:101074288-101074310 CAGAGCCAGCAGTGTGTGGGGGG - Intergenic
1122799464 14:104222458-104222480 CAGCACCATCAGAAGACGGGAGG - Intergenic
1123168511 14:106349181-106349203 CAGGACCAGCAGGGGGCGCGCGG - Intergenic
1123197054 14:106627147-106627169 CAGCGCCAGCAGGGGGCGCGCGG - Intergenic
1123222828 14:106872728-106872750 CAGGACCAGCAGGGGGCGCGCGG - Intergenic
1123584153 15:21742262-21742284 CAGGACCAGCAGGGGGCGCGGGG - Intergenic
1123620803 15:22184865-22184887 CAGGACCAGCAGGGGGCGCGGGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1125433978 15:39626394-39626416 CAGCACCAGTACAAGGTGGAGGG - Intronic
1128554747 15:68623699-68623721 GAGCAGCAGCAGCGGGTGGGAGG + Intronic
1129473566 15:75768213-75768235 CAGCCCCATCAGTGAGTGGGAGG - Intergenic
1129731810 15:77936612-77936634 CAGCCCCATCAGTGAGTGGGAGG - Intergenic
1131264973 15:90910430-90910452 CTGCACTGGCAGAGTGTGGGTGG + Intronic
1131324490 15:91429432-91429454 AAACACCAGCAGTGAGTGGGTGG + Intergenic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1132468781 16:90225-90247 CTGCAGCAGCACAGGGTGGGGGG - Intronic
1132651377 16:1022797-1022819 CGGCACCAGCTGAGGCTTGGTGG + Intergenic
1132659461 16:1054979-1055001 CAAAGCCAGCAGAGAGTGGGTGG + Intergenic
1132683697 16:1153703-1153725 CAGCACCTGCAGAGGACAGGGGG - Exonic
1132907126 16:2288387-2288409 CAGCACCTGCCGCAGGTGGGTGG - Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1132975399 16:2708753-2708775 TAGCCCCAGCAGAGCCTGGGAGG + Exonic
1132994220 16:2814702-2814724 AAGCACCAGCTGAGGTTGAGGGG + Intergenic
1132996793 16:2827686-2827708 AAGCACCAGCTGGGGTTGGGGGG - Intergenic
1133090685 16:3401504-3401526 CAGCGCCAGCCGGGGGTGTGAGG - Exonic
1133221462 16:4320822-4320844 GAGCACCAGCACAGGGTTGGGGG - Intronic
1133255870 16:4515224-4515246 CAGCACCTGCAGGGGATGGAGGG + Intronic
1134231723 16:12435073-12435095 CAGGCCCAGGAGAGGGTTGGAGG + Intronic
1135874061 16:26181015-26181037 CAGCATCAAGAGAGGGTGCGAGG + Intergenic
1136265104 16:29111580-29111602 CAGCACCAGCAGAGCGGGGCAGG + Intergenic
1136393373 16:29979078-29979100 CAGCACCGGCAGTGCCTGGGAGG + Intronic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1137746561 16:50824745-50824767 CAGGACCAGCACAGCCTGGGGGG - Intergenic
1137984825 16:53099032-53099054 CACTACCCACAGAGGGTGGGTGG + Intronic
1138426014 16:56932429-56932451 CATCCCCAGCAGAGGGCGGGGGG - Intronic
1138474672 16:57263727-57263749 CTCCACCAGCAAGGGGTGGGTGG - Intronic
1138519867 16:57564856-57564878 CAGCACATGCAAAGGCTGGGAGG + Intronic
1138688782 16:58749000-58749022 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
1138815568 16:60199405-60199427 CACCAACAGCAGGAGGTGGGGGG + Intergenic
1139496917 16:67326713-67326735 CGGCTCCAGCAGCGGGCGGGCGG + Exonic
1140008057 16:71099407-71099429 AGGCACCAGCAGATGGTGGAAGG - Intronic
1141130867 16:81435709-81435731 CAGCAACAGCGGGGGGTTGGGGG - Intergenic
1142053901 16:87979555-87979577 CAGCACCAGCAGAGCGGGGCAGG + Intronic
1142350505 16:89577193-89577215 CAGCACCAGCTGAGTGGGGAGGG - Intronic
1142626837 17:1197654-1197676 GACCACCAGCAGAGAGGGGGAGG + Intronic
1142785039 17:2214541-2214563 CAGCACCAGCCCTGGGTGAGGGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143421192 17:6793915-6793937 CTGCAACAGCAGAGAGTGTGGGG - Intronic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144626041 17:16844945-16844967 TAGCACCTGCTGCGGGTGGGAGG - Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144852752 17:18252267-18252289 CAGCCCCAGAGGTGGGTGGGAGG - Intronic
1144880393 17:18427775-18427797 TAGCACCTGCTGCGGGTGGGAGG + Intergenic
1145151842 17:20516612-20516634 TAGCACCTGCTGCGGGTGGGAGG - Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145274050 17:21419631-21419653 CAGCACCAGCAGAGGCTCAGGGG - Exonic
1145311913 17:21705530-21705552 CAGCACCAGCAGAGGCTCAGGGG - Intergenic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1146011163 17:29196020-29196042 GAACACAAGCAAAGGGTGGGAGG + Intergenic
1146646751 17:34581338-34581360 CGGCGCCAGAAAAGGGTGGGGGG + Intronic
1147262143 17:39214824-39214846 CAGCCCCAGCAGAGAGTGAAGGG - Exonic
1147305537 17:39561671-39561693 CAGCTCCAGCAGGAGGTGGGAGG - Intronic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147543666 17:41381891-41381913 GAGCTCCAGCAGAAGGTGAGGGG - Exonic
1147545346 17:41397184-41397206 GAGCTCCAGCAGAAGGTGAGCGG - Exonic
1147582615 17:41635811-41635833 CAGCACCTTCACAGGCTGGGCGG - Intergenic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148795675 17:50195578-50195600 CAGCACCAGCAGGGCCAGGGGGG + Exonic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1149648901 17:58263899-58263921 CAGCACCAGCAGGGATTGAGTGG - Intronic
1149676752 17:58471698-58471720 CAGCACCTTCAGAGGCTGAGAGG - Intronic
1149753979 17:59172668-59172690 CAGCAGCTGCAGGGGGTGCGCGG + Intronic
1150286237 17:63955829-63955851 CAGCACCAAGAGAGGGAAGGGGG - Intronic
1151306796 17:73267768-73267790 CAGCAGCAGCGGCGGGTGAGGGG - Intergenic
1151370408 17:73643724-73643746 CAGCCACAGCAGACGGGGGGAGG + Intronic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151670614 17:75569946-75569968 CAGCACCTGCGCAGGGTGGCAGG - Exonic
1151696692 17:75721584-75721606 CAGCAGCAGCCGAGGCTGGCCGG + Exonic
1152245159 17:79181645-79181667 CAGCAGTGGCAGAGGGTGGCCGG - Intronic
1152252861 17:79220815-79220837 CAGCTCCTGCAGAGGCGGGGCGG + Intronic
1152466042 17:80466662-80466684 CAGCATCACCAGACGGTGTGGGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152688357 17:81706024-81706046 CAGCACCACCCGAGGGCAGGGGG - Intronic
1152799076 17:82322762-82322784 GGGCTCCAGGAGAGGGTGGGGGG - Intronic
1153749155 18:8211309-8211331 CAGCATCAGAACAGGGTGGAAGG + Intronic
1154162669 18:11991562-11991584 CAGGACCGGCAGGAGGTGGGTGG + Intronic
1155611704 18:27674077-27674099 CAGCAGCTGCGGAGGGTGCGCGG - Intergenic
1156465861 18:37347573-37347595 AACCTCCAGCAGAGGGTGTGCGG - Intronic
1156511732 18:37642414-37642436 CAGCTGTGGCAGAGGGTGGGGGG + Intergenic
1158387529 18:57012358-57012380 CAGCACCAGGATAGGAAGGGAGG + Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160583597 18:79901030-79901052 GACAAGCAGCAGAGGGTGGGGGG - Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161060256 19:2211159-2211181 CGCCACCAGCAGCGGGTTGGGGG - Exonic
1161198845 19:3003028-3003050 CAGCACCATCAGGGGTTGCGGGG + Intronic
1161296798 19:3524236-3524258 CAGGCCCAGCAGTGCGTGGGAGG + Intronic
1161360904 19:3849164-3849186 CAGCACCAGCAGAGGGCTGTGGG + Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1162183942 19:8889868-8889890 TAGCACCAGGAGAGGGCTGGCGG + Exonic
1162463849 19:10829494-10829516 AGGCACCAGCAGAGGGCAGGCGG - Intronic
1162525728 19:11205077-11205099 CAGCACCCGCTGGGGGTGAGGGG - Intronic
1163256499 19:16159133-16159155 CAGCACTTGAGGAGGGTGGGAGG + Intergenic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1164752408 19:30666437-30666459 GATCCCCAGCAGAGGATGGGAGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165720801 19:38078281-38078303 GAGCACCAGAAGAGGGCAGGTGG - Intronic
1166067415 19:40367906-40367928 CAGCAGGGGCAGGGGGTGGGAGG + Intronic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
1166560822 19:43731412-43731434 CAGCCCCAACTGAGGGTGGGGGG + Exonic
1167172842 19:47844823-47844845 CAGCACTTGCAGAGGCTGAGGGG - Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
1168719964 19:58549459-58549481 CAGCACCAGCTCAGGGCTGGAGG + Exonic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925118370 2:1398863-1398885 CAGGACTGACAGAGGGTGGGGGG + Intronic
925336201 2:3101008-3101030 CAGCCCCAGCAAATGGTGGGAGG + Intergenic
925495824 2:4448071-4448093 CAGAACCAGTCGATGGTGGGTGG - Intergenic
926098228 2:10096648-10096670 CATCACCAGAACAGGGTGGCCGG - Intergenic
926645772 2:15288398-15288420 CACACCCAGCAGAGGGTGGGAGG + Intronic
927693245 2:25223006-25223028 CACCCCCAGCAGTGGGTGTGGGG - Intergenic
927701328 2:25270654-25270676 CAACACTGGCAGAGGGTGGGGGG + Intronic
928203144 2:29264171-29264193 GAGACACAGCAGAGGGTGGGTGG - Intronic
928512078 2:32011036-32011058 TAGCGGCAGCAGAGGCTGGGAGG + Intronic
928843484 2:35639471-35639493 CAGCACTGGCAGGGTGTGGGAGG + Intergenic
928843592 2:35641421-35641443 CAGCACTGGCAGGGTGTGGGAGG + Intergenic
929048420 2:37813459-37813481 CAGCCCCAGCACAGGATGGCGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930768771 2:55111588-55111610 GACTCCCAGCAGAGGGTGGGAGG - Intronic
931516941 2:63055534-63055556 CAGCAGCAGCAGAGCGGGAGCGG + Exonic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932175820 2:69600703-69600725 AAGCAGCAGCAGAGTTTGGGAGG + Intronic
932414684 2:71566524-71566546 GAGCACCAGCAGAGAGAGAGAGG + Intronic
932565264 2:72902047-72902069 TAGGACCAGTAGGGGGTGGGTGG + Intergenic
932599374 2:73113100-73113122 CGGCCTCTGCAGAGGGTGGGCGG + Intronic
933774210 2:85761997-85762019 CAGCACCCCCAGAGGGTGGAGGG + Intronic
934477946 2:94605406-94605428 AAGCAGCTGCAGAGGTTGGGTGG + Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
937261013 2:120586880-120586902 CAGCCCCAGCAGGGGGTAGGAGG + Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
938090309 2:128426833-128426855 CAGCAGGAGGAGAGGATGGGGGG + Intergenic
938115983 2:128603243-128603265 CAACACAAGCAGATGATGGGTGG - Intergenic
941218285 2:162740445-162740467 CAGCACCAGATGGGAGTGGGTGG + Intronic
942081139 2:172400569-172400591 ATGCACCAGCAGAGGAAGGGTGG - Intergenic
944310774 2:198231671-198231693 CAGCAACAGCAGAGTGGGAGGGG - Intronic
944991987 2:205248423-205248445 CAGCAGCAGCAGAGGGTTAAGGG + Intronic
946190270 2:218004077-218004099 CTGGACCAACTGAGGGTGGGTGG + Intergenic
946302510 2:218832503-218832525 CAGCACTCACAGAGGGTTGGGGG - Intergenic
947523399 2:230864980-230865002 CTGCACCGGCAGAGGCTGCGGGG + Exonic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948574203 2:238939386-238939408 CAAGATCAGCAGAGGGTCGGGGG - Intergenic
948735730 2:240003772-240003794 GAGAAGCAGCAGGGGGTGGGTGG + Intronic
948789363 2:240369441-240369463 CAGAACCAGATGTGGGTGGGGGG - Intergenic
948939080 2:241187339-241187361 CAGCACCAGCAGAGCCTGGGCGG - Intergenic
949044566 2:241866606-241866628 CAGGACCGGCAGCTGGTGGGGGG - Intergenic
949052158 2:241903162-241903184 CTGCACCGGCAGATGGTGGCAGG + Intergenic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1170684799 20:18559530-18559552 CTGAACCAGCAAAGGCTGGGTGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171796803 20:29572771-29572793 AATTAGCAGCAGAGGGTGGGTGG - Intergenic
1171851444 20:30311395-30311417 AATTAGCAGCAGAGGGTGGGTGG + Intergenic
1172183073 20:33015438-33015460 CAGGACCAGCAGCGCGTGGGAGG - Exonic
1172269211 20:33644054-33644076 CAGCACCAGCCTAGGGCAGGTGG - Intronic
1172310358 20:33913362-33913384 GAGCACAAGCAGGGGCTGGGTGG - Intergenic
1172701165 20:36854536-36854558 CAGCACCCGCAGAGCTTGGGCGG + Intronic
1172892896 20:38279532-38279554 CAGCATGAGCAGAGGTTTGGAGG + Intronic
1172937318 20:38629496-38629518 CCGCAGCAGCAGAGCCTGGGGGG + Exonic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173862707 20:46294684-46294706 CCACCCCAGCAGAGGTTGGGGGG - Intronic
1174385758 20:50187749-50187771 CATCCCCAGCAGGGGGTGGAGGG + Intergenic
1175429560 20:58891842-58891864 CAGCAGCAGCAGGCGGTGCGTGG - Intronic
1175498017 20:59428654-59428676 TGGCACCAGAAGAGGGTGAGGGG + Intergenic
1175499811 20:59441791-59441813 GACCACGAGCAGAGGGTCGGTGG - Intergenic
1175552192 20:59824766-59824788 CAGCCCCACCAGTGGGGGGGCGG + Intronic
1175822450 20:61917656-61917678 CAGCTCCAGCACCGGCTGGGCGG - Intronic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1175950592 20:62581282-62581304 CAGTCCCAGCATGGGGTGGGGGG - Intergenic
1175984904 20:62759791-62759813 CAGCAGCAGCCCAGGCTGGGCGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176524872 21:7858354-7858376 CAGCACTGGCGGAGGGTGGGAGG + Intergenic
1177549102 21:22597947-22597969 CAGCAGCTGCAGAGGGTGCCGGG + Intergenic
1178658892 21:34488367-34488389 CAGCACTGGCGGAGGGTGGGAGG + Intergenic
1178976882 21:37227835-37227857 CAGGGCCAGCAGAGGCTGCGGGG + Intronic
1179174914 21:39001181-39001203 CAGCAGCAGCAGAGATGGGGTGG - Intergenic
1179382458 21:40912004-40912026 CCACACCAGCAGTGGGTGTGGGG + Intergenic
1179400096 21:41075805-41075827 CAGTACCGGTGGAGGGTGGGAGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179586751 21:42378209-42378231 CAGCACTGCCAGTGGGTGGGGGG + Intronic
1179935668 21:44602224-44602246 CAGGACCACCCGCGGGTGGGGGG - Intronic
1180057370 21:45365820-45365842 CAAGGCCAGCAGACGGTGGGAGG - Intergenic
1180095078 21:45552645-45552667 CAGCCCCAGCAGAGAGGGGCTGG + Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1180931718 22:19596757-19596779 CCCCAGCAGCAGAGGGTGGTGGG - Intergenic
1181179369 22:21056016-21056038 GAGCCCCTGCAGAAGGTGGGAGG - Intronic
1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG + Intronic
1181638992 22:24187122-24187144 CAGCCCCAGGACAGGGTGGTCGG - Intronic
1182033100 22:27175363-27175385 CAGCGACTTCAGAGGGTGGGCGG - Intergenic
1182193447 22:28489033-28489055 CAGCACTTTCAGAGGCTGGGGGG + Intronic
1182351153 22:29700750-29700772 CATCTCCAGCAGAGAGAGGGAGG + Intergenic
1182625078 22:31639776-31639798 GAGCACAGACAGAGGGTGGGTGG - Intronic
1183083573 22:35472893-35472915 CAGCTCGAGCAGAGGCTGGCAGG - Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183360468 22:37380498-37380520 CAGCTCCAGGAGCAGGTGGGGGG + Intronic
1183432478 22:37774188-37774210 AAGCCCAAGCAGAGGGTGGCTGG - Exonic
1183656779 22:39190365-39190387 CCGCAGCAGCTGAGGGTTGGAGG + Intergenic
1184806279 22:46796724-46796746 GGGCAGCAGCAGAGGGCGGGAGG + Intronic
1184871067 22:47238761-47238783 CAGGACCGGCAGCTGGTGGGAGG - Intergenic
1185081354 22:48711062-48711084 CTCCACCAGCAGAGGCTTGGGGG - Intronic
1185098785 22:48826470-48826492 CAGCACGAGCTGTTGGTGGGAGG - Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
950421320 3:12901325-12901347 CAGGACCACCGGTGGGTGGGGGG + Intronic
950508267 3:13409741-13409763 CAGCACCAGGTAAAGGTGGGAGG - Intronic
950528224 3:13536976-13536998 CAGCACAAGCAGGAGCTGGGAGG + Intergenic
950543275 3:13624856-13624878 CAGCACCAGGAGGGGGTAGATGG + Intronic
953147399 3:40291154-40291176 CAGCACTGGCATAGGGTGAGAGG + Intergenic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954091614 3:48288938-48288960 CAGCACTAGGAGTGGGTGAGTGG + Intronic
954427024 3:50448810-50448832 GGGCACCAGCACAGTGTGGGTGG - Intronic
954628439 3:52035500-52035522 CATCACCAGGACAGGGTGGTGGG + Intergenic
956249216 3:67218195-67218217 CAGCAGTGGCAGTGGGTGGGTGG - Intergenic
956864439 3:73355565-73355587 CAGCACCTTCAGAGGGAGCGGGG + Intergenic
957078783 3:75620320-75620342 GCGCTCCAGCAGTGGGTGGGGGG - Intergenic
958542435 3:95496165-95496187 CAGCAGGAGAGGAGGGTGGGTGG - Intergenic
959585744 3:108023596-108023618 CAGCACCAGCAGAGTGGGGCAGG - Intergenic
960080295 3:113533495-113533517 CAGGACCCGCAGACGGTGCGGGG - Intronic
960479547 3:118171542-118171564 CAGCAGCTGCAGAGGGTGCCCGG + Intergenic
960669206 3:120140395-120140417 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
961268781 3:125671823-125671845 CAGCAGCTGCAGAGGGTGCATGG + Intergenic
961376386 3:126468858-126468880 CAGCAACAGCACAGTGGGGGTGG - Intronic
961627019 3:128271157-128271179 CAGCCCCAGCAGGAAGTGGGGGG - Intronic
961714257 3:128847869-128847891 CTGCAACAGCTGTGGGTGGGAGG - Intergenic
961781132 3:129320542-129320564 CTGCAGCAGCAGCGGATGGGAGG + Intergenic
961986518 3:131140436-131140458 CATCACCAGCAGATGCTGTGGGG + Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
963748454 3:149149513-149149535 AAGCACCAGCAGATGGAGAGAGG + Intronic
963938449 3:151077706-151077728 CAGCACCAACAGTGGATGGGGGG - Intergenic
966687162 3:182708624-182708646 GAGATCTAGCAGAGGGTGGGAGG - Intergenic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
967871001 3:194228990-194229012 GAGCATCTGTAGAGGGTGGGGGG - Intergenic
968010318 3:195270355-195270377 CAGCACCAGCTGAGGGCGTCTGG + Intronic
968092821 3:195909143-195909165 CAGCACCAGGAGAAGGGCGGAGG - Intronic
968490681 4:889125-889147 CAGCAGGAGCAGGGAGTGGGTGG + Intronic
968617260 4:1583230-1583252 CAGCACCAAGAGGAGGTGGGCGG + Intergenic
968864585 4:3199843-3199865 CAGCACCAGGGCCGGGTGGGTGG - Exonic
969112876 4:4854660-4854682 CAGTTCCGGCAGGGGGTGGGAGG - Intergenic
969477867 4:7431549-7431571 CTGCTCCTGGAGAGGGTGGGTGG + Intronic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
969969315 4:11029298-11029320 CAGCACCAGTAGTGGGGGGCTGG - Intergenic
971017916 4:22507614-22507636 CAGCACCAGGAGAAGTTGGTGGG - Intronic
972225646 4:37008145-37008167 CAGCCCCAGCTGAGGGTTGAGGG + Intergenic
973142090 4:46781825-46781847 CAGCAGCTGCAGAGGATGTGCGG + Intronic
973255853 4:48112443-48112465 CAGCAACCTCAGAGGGTGGGAGG + Exonic
973826500 4:54712360-54712382 CAGCAACAGCAGATCGTGGGTGG + Intronic
973828930 4:54738523-54738545 GTGCACAAGCAGAGGCTGGGAGG - Exonic
974026001 4:56733637-56733659 CACCACCATCAGAGGGGGTGTGG + Intergenic
975558345 4:75686541-75686563 CAGCAAGAGCAAAGGGTGGGTGG + Intronic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976839129 4:89410789-89410811 CAACACTAGCAGACTGTGGGTGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
979946830 4:126843292-126843314 CAGCACTGGAAGAGGGAGGGAGG - Intergenic
982430564 4:155317412-155317434 TAGTACAAGCAGTGGGTGGGGGG + Intergenic
982731996 4:158965869-158965891 AAGCACTAGGAGATGGTGGGTGG + Intronic
983117458 4:163836027-163836049 CATCACCAGCCTAGGCTGGGAGG - Intronic
983831081 4:172329286-172329308 TAGCCCCAGCAGGGGGTGGCTGG + Intronic
983998582 4:174214427-174214449 GAGCCCTAGCTGAGGGTGGGGGG + Intergenic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
984839740 4:184057163-184057185 CAGCAGCCCCAGGGGGTGGGAGG + Intergenic
985606608 5:861437-861459 CAGAACCACCAAAGGGTGGGAGG + Intronic
985676124 5:1232178-1232200 CAGCACCTGCCCAGGGTCGGGGG - Intronic
985711504 5:1432185-1432207 CAGCGGCAGCTCAGGGTGGGAGG - Intronic
986732464 5:10645372-10645394 CAGGACTAGCAGGAGGTGGGTGG - Intronic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987146213 5:14993889-14993911 CAGCACACGGAGCGGGTGGGAGG + Intergenic
992402009 5:76420133-76420155 CATCACCAGTAGTGGGAGGGTGG - Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993659018 5:90607363-90607385 CAGCAGCAGCACAGGATGGAAGG - Intronic
994948161 5:106423243-106423265 CAGCACCAGCAGAGGGTGAGAGG - Intergenic
995831668 5:116361478-116361500 CAGGACCTGCGGAGGGAGGGAGG - Intronic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
996854296 5:127987703-127987725 GGACACCAGGAGAGGGTGGGTGG + Intergenic
996995171 5:129686956-129686978 CATCAGCAGGAGAGGATGGGAGG - Intronic
997604771 5:135166825-135166847 CAGCAGCAGTGGAGGGTGTGAGG + Intronic
998080883 5:139274108-139274130 CAGCACCGGCAGAGGCCGGAGGG - Exonic
998804447 5:145904829-145904851 CAGCACCAACAGAGCATGTGAGG - Intergenic
999312204 5:150558701-150558723 CAGCTCCAGCAGATGTGGGGTGG + Intergenic
999419328 5:151427395-151427417 CTCCACCAGCAGAGGGTGACAGG + Intergenic
1001462024 5:171924624-171924646 TGGCACCGGCAGAGGGTGGAGGG - Intronic
1001929240 5:175661030-175661052 GTGGACCAGCAGAGGGTGGGTGG - Intronic
1001993394 5:176134954-176134976 CAGCCCCTGACGAGGGTGGGTGG - Intergenic
1002060333 5:176621855-176621877 CAGCAGACGCAGCGGGTGGGGGG - Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002570512 5:180137049-180137071 AAGCGGCAGCAGAGGGCGGGAGG + Intronic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1003935196 6:10968742-10968764 CAGCATCAGGTGAGGGTGTGGGG + Intronic
1004205696 6:13589775-13589797 TAGCAGCAGCAGAGGGTGGGAGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004843722 6:19615083-19615105 CAGCAGCAGAAGTGGGTGTGTGG - Intergenic
1005306864 6:24522345-24522367 CAGCAACAGCAGAGGCTAAGAGG - Intronic
1006507308 6:34497682-34497704 CAGCCCCAGCAGAGCGTGGGAGG - Intronic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007237093 6:40398403-40398425 GAGCAGCAGCAGAAGGTCGGCGG - Intronic
1007606382 6:43120972-43120994 CAGCCCCAGAAGAAGATGGGCGG + Intronic
1007634798 6:43292889-43292911 CAGCACGGGCAAAGAGTGGGGGG + Intergenic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008978871 6:57459947-57459969 CTGCAGCAGAAGAGGGTGTGAGG + Intronic
1009355663 6:62740673-62740695 CAGCATAAGCCGGGGGTGGGGGG - Intergenic
1009656851 6:66558486-66558508 CAGCTCCAGCTGGGGGTTGGAGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1009705168 6:67239809-67239831 CAGCACCAGCAGAGTGGGCTTGG - Intergenic
1010764665 6:79765324-79765346 CAGCACCAGCAGAGGGCAAGAGG - Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1012316866 6:97791460-97791482 CGGCACCGGCGGAAGGTGGGAGG + Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1012878963 6:104762538-104762560 CAGGGCCTGCTGAGGGTGGGGGG + Intronic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1013993194 6:116278460-116278482 CAGGTCCAGCAGAAGGTGGTAGG + Exonic
1014018872 6:116565527-116565549 CTGCACTAGCAGAGGGTGGGAGG + Intergenic
1014736171 6:125098435-125098457 CAGCCCCCGGAGTGGGTGGGTGG + Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1016116270 6:140290159-140290181 CAGGACCAGCAAAGGATGAGGGG - Intergenic
1018003687 6:159601433-159601455 CAGCAGCAGCAAAGCATGGGTGG + Intergenic
1018291343 6:162295126-162295148 CAGCACCAGCGAATGCTGGGAGG - Intronic
1018313557 6:162534758-162534780 CAGCTCCAGTAGAGGCTGTGTGG + Intronic
1019025833 6:168962334-168962356 CAGCCCCAGCACCGGGTGGCCGG + Intergenic
1019436656 7:1025696-1025718 CAGCACCGGTAGAGGTTGCGTGG + Intronic
1019739609 7:2666105-2666127 CAGGCCCAGCAGAGGATGCGGGG + Intergenic
1019921610 7:4166888-4166910 CAGCAACGGCAGAGGGTCCGAGG + Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020006811 7:4787782-4787804 CAGCGCTGGCAGAGGGTGAGGGG - Intronic
1020685499 7:11288854-11288876 CAGCAGCAGTAGATGGTGGTGGG - Intergenic
1021279691 7:18702385-18702407 CAGCACCTCCAGAGAGTGGATGG + Intronic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021824317 7:24532867-24532889 CAGCACCATAAGACAGTGGGTGG - Intergenic
1021862955 7:24925249-24925271 AAGCACATGTAGAGGGTGGGTGG + Intronic
1022094759 7:27131412-27131434 CAGAAGCTGCAAAGGGTGGGCGG + Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1023579431 7:41665705-41665727 CGGGACCGGCAGAGGGGGGGTGG + Intergenic
1024698403 7:51880606-51880628 CAGGGCCTGCAGTGGGTGGGGGG - Intergenic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1025950605 7:66142331-66142353 CAGCTCCAGCCGAAGGAGGGAGG - Intronic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1027681924 7:81232737-81232759 CAGCACCAGCGGAGGGCAGGAGG + Intergenic
1028128915 7:87147313-87147335 CAACACCAGCAGATGGCGGGAGG + Intergenic
1028198484 7:87934339-87934361 CAGCACCGGCCGGGGCTGGGTGG + Intronic
1028392673 7:90334568-90334590 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029115086 7:98232570-98232592 CAGCAACCTCAGAGGGTGGTGGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1031657724 7:124379400-124379422 CACCCCCAGCAGAGGCTGTGTGG + Intergenic
1032520137 7:132537616-132537638 CAGACCCGGAAGAGGGTGGGAGG + Intronic
1032649091 7:133857979-133858001 CAACACCAGCGGAGGGCAGGAGG + Intronic
1033220321 7:139523361-139523383 GAGCCACAGCAGAGGGTGGTAGG - Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033652821 7:143355205-143355227 GAGCACAGGCAGAGGATGGGCGG - Exonic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1034467434 7:151238297-151238319 CAGCACCAGGAGGGGAGGGGGGG - Exonic
1034811645 7:154137625-154137647 CAGCAGGAGGAGATGGTGGGGGG + Intronic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1035062022 7:156076354-156076376 CAGTGCCAGCACAGGTTGGGGGG + Intergenic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1035418364 7:158707452-158707474 GGGCGCCAGCAGAGGGTGGGAGG + Intergenic
1035478212 7:159158801-159158823 CCGCACCAGCACCCGGTGGGAGG - Intergenic
1035561355 8:606437-606459 TTGCACCAGCAAAGGGTGTGGGG - Intergenic
1036022627 8:4862910-4862932 CAGCACCAAGAGAGGCTGGAGGG + Intronic
1036288407 8:7464652-7464674 AAGCACCAGCAAAGGGCGGAAGG + Intergenic
1036333068 8:7846876-7846898 AAGCACCAGCAAAGGGCGGAAGG - Intergenic
1036807550 8:11845849-11845871 CATGACCAGCTGAGTGTGGGGGG - Intronic
1037005154 8:13768863-13768885 CCAAACCAGCAGAGGATGGGGGG + Intergenic
1037539618 8:19858265-19858287 TGGCACCAGTGGAGGGTGGGAGG + Intergenic
1037755844 8:21709683-21709705 CAGTACCTGCAGAGAGTGTGTGG - Intronic
1038788789 8:30648099-30648121 CAGAACCAAAAGAGGGTAGGAGG + Intronic
1038865770 8:31437233-31437255 CAGCAGCAGAGGGGGGTGGGGGG + Intergenic
1039796784 8:40922629-40922651 CATCAGCAGCAGTGGGTGAGGGG + Intergenic
1041012640 8:53559330-53559352 TAGCCCCAGCAGTGGGTGGCTGG - Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1042297082 8:67232182-67232204 CATCACAAGTAGGGGGTGGGAGG + Intronic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042898278 8:73694883-73694905 CAGCACCTGCACAGGGAGGGAGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046054108 8:109058976-109058998 CAGCCCCAGCAGAGGCCGTGTGG - Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1048223470 8:132564099-132564121 CACCACCAGCAGGGGGTCAGGGG + Intergenic
1048607316 8:135982899-135982921 GATAAACAGCAGAGGGTGGGAGG + Intergenic
1048980908 8:139703138-139703160 CAGCAGCAGCAGCGGGGAGGCGG + Intergenic
1049011044 8:139887596-139887618 CAGAACACGCAGAGTGTGGGAGG - Intronic
1049053924 8:140220173-140220195 CAGCGCCAGGGGAGGGTGGTGGG + Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049566349 8:143341130-143341152 CAGCACGAGAAGAGGGTGGCGGG - Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1051628657 9:19122829-19122851 ATGGACCAGCAGGGGGTGGGTGG - Intronic
1052766986 9:32651118-32651140 TAGCCCCAGCAGGGGGTGGCTGG - Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053466466 9:38312143-38312165 CTGAACCAGCAGGGGCTGGGAGG + Intergenic
1053680113 9:40480702-40480724 AAGCAGCTGCAGAGGTTGGGTGG - Intergenic
1053789220 9:41674651-41674673 AATTAGCAGCAGAGGGTGGGTGG + Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1053930106 9:43109012-43109034 AAGCAGCTGCAGAGGTTGGGTGG - Intergenic
1054155920 9:61640112-61640134 AATTAGCAGCAGAGGGTGGGTGG - Intergenic
1054177501 9:61886004-61886026 AATTAGCAGCAGAGGGTGGGTGG + Intergenic
1054283599 9:63144233-63144255 AAGCAGCTGCAGAGGTTGGGTGG + Intergenic
1054293193 9:63316212-63316234 AAGCAGCTGCAGAGGTTGGGTGG - Intergenic
1054391221 9:64620705-64620727 AAGCAGCTGCAGAGGTTGGGTGG - Intergenic
1054475691 9:65571112-65571134 AATTAGCAGCAGAGGGTGGGTGG - Intergenic
1054504508 9:65895622-65895644 AAGCAGCTGCAGAGGTTGGGTGG + Intergenic
1054660030 9:67694804-67694826 AATTAGCAGCAGAGGGTGGGTGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056276728 9:85001152-85001174 TAGCACCAGAAGAGGGAGAGGGG - Intronic
1056410756 9:86324290-86324312 CAGCAGCAGCAGAGCCTGGTGGG - Intronic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1058823394 9:108753613-108753635 AGGCACCAGCACGGGGTGGGTGG - Intergenic
1058980216 9:110161993-110162015 CCACACCAGAAGAGGATGGGAGG - Intronic
1060057902 9:120431571-120431593 CATCATCATCAGAGGGTGGTGGG + Intronic
1060178691 9:121516659-121516681 CAGGACCAAGAGATGGTGGGGGG - Intergenic
1060685148 9:125603443-125603465 CAACACAAGCAAAGGGTGTGAGG + Intronic
1060766199 9:126296446-126296468 CAGCCCCAGGCGTGGGTGGGTGG - Intergenic
1060997481 9:127883291-127883313 CAGCCCCAGCAGAGGTTTCGAGG - Intergenic
1061306675 9:129736471-129736493 CAGCTCCAGCCTGGGGTGGGCGG - Intergenic
1061381866 9:130263744-130263766 GAGCAGCAGCGGGGGGTGGGGGG - Intergenic
1061420012 9:130468059-130468081 CATCTCCAGGAGAGGGTAGGTGG - Intronic
1061806624 9:133140700-133140722 CAGCACCCACGCAGGGTGGGTGG + Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1061817689 9:133206504-133206526 CAGCACCAGGACAGGGGGAGAGG + Intronic
1062107234 9:134762384-134762406 GAGGAGCAGAAGAGGGTGGGGGG + Intronic
1062127030 9:134869462-134869484 CAGACCCCGCAGAGGGTGGAGGG + Intergenic
1062137834 9:134939024-134939046 CTGCAGCAGCAGAGGGGTGGGGG - Intergenic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062466388 9:136683479-136683501 GAGCCCCAGCAGAGGGGGAGGGG - Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186199488 X:7142612-7142634 CAGCAGCAGCAGAGTTTGAGAGG + Intronic
1186475977 X:9857982-9858004 CAGCGCTCGCAGAGGCTGGGAGG - Intronic
1188800120 X:34519033-34519055 CATCACCAGCATAGAGTGTGAGG - Intergenic
1189940818 X:46118731-46118753 CAACAAAAGCAGAGGGTAGGAGG - Intergenic
1190292467 X:49001746-49001768 CAGAACCATTAGCGGGTGGGAGG - Intronic
1191618605 X:63192656-63192678 CAGCCCACGGAGAGGGTGGGAGG + Intergenic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192668488 X:73113533-73113555 AAGCAGCAGCAGAGTTTGGGAGG - Intergenic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1194668166 X:96698364-96698386 AAGCAGCAGGAGAGGGTAGGTGG - Intronic
1195063084 X:101215428-101215450 GAACAGCAGAAGAGGGTGGGAGG + Intergenic
1196535753 X:116841534-116841556 CTTCACCAGTAAAGGGTGGGTGG + Intergenic
1197354354 X:125418577-125418599 CAAAACCAGCAGAGGCTGGGTGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197551111 X:127893907-127893929 CAGCAGAAGCAAGGGGTGGGGGG - Intergenic
1198683066 X:139203093-139203115 TAGAACCGGCAAAGGGTGGGGGG + Intronic
1200080050 X:153571801-153571823 GTGCTCCAGCAGAAGGTGGGTGG + Intronic
1200085772 X:153604063-153604085 CAGCCACAGGAAAGGGTGGGGGG - Intergenic
1200105660 X:153710628-153710650 CAGCAGCAGCAGACTATGGGGGG + Intronic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic