ID: 1065830631

View in Genome Browser
Species Human (GRCh38)
Location 10:29610755-29610777
Sequence ATTCATGAAAAGATGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065830631_1065830635 1 Left 1065830631 10:29610755-29610777 CCAACCTCCATCTTTTCATGAAT 0: 1
1: 0
2: 0
3: 30
4: 355
Right 1065830635 10:29610779-29610801 AAAAATCCCACCCACCCTTTGGG No data
1065830631_1065830634 0 Left 1065830631 10:29610755-29610777 CCAACCTCCATCTTTTCATGAAT 0: 1
1: 0
2: 0
3: 30
4: 355
Right 1065830634 10:29610778-29610800 CAAAAATCCCACCCACCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065830631 Original CRISPR ATTCATGAAAAGATGGAGGT TGG (reversed) Intronic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
905969386 1:42129805-42129827 ATTCTTGAGAGGAAGGAGGTGGG - Intergenic
906683718 1:47749010-47749032 ATTCTTTGAAAGATGGAGTTGGG + Intergenic
907681588 1:56569084-56569106 ATTCATGAAAAGATTGGAGGAGG - Intronic
907835266 1:58102687-58102709 ATTCATTAAAAGAAAAAGGTGGG - Intronic
908260257 1:62334790-62334812 ATTCATGACAAGATCCAGGGTGG + Intergenic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
909028362 1:70509325-70509347 ATTCAGTTTAAGATGGAGGTTGG + Intergenic
909101262 1:71352295-71352317 ATTCAAGAAAAGATTTAGGTGGG - Intergenic
909813648 1:79962727-79962749 AGTAATAAAAAGATGGAGGTAGG + Intergenic
910025311 1:82643314-82643336 ATTAATGACAAGAAGGAGGATGG - Intergenic
910047323 1:82933259-82933281 ATTCAAGATGAGATTGAGGTGGG + Intergenic
910538220 1:88324091-88324113 ATTCAAGATAAGATTTAGGTGGG + Intergenic
911951759 1:104182319-104182341 ATTCAAGATAAGATGTGGGTGGG - Intergenic
911969685 1:104415993-104416015 ATTCAAGATAAGATGTGGGTGGG + Intergenic
912143533 1:106761728-106761750 ATACATGAAAAAATTGTGGTAGG - Intergenic
912179984 1:107208127-107208149 ATTCATGCAGAAATGGAGGGAGG + Intronic
912425653 1:109587546-109587568 ATATATGAGAATATGGAGGTAGG + Intronic
913527472 1:119707866-119707888 CTTCCTGAAAAGGTGGAGCTTGG - Intronic
913559180 1:120000864-120000886 ATTCATCAAAAGGTGTTGGTGGG - Intronic
913638685 1:120789678-120789700 ATTCATCAAAAGGTGTTGGTGGG + Intergenic
914279774 1:146160307-146160329 ATTCATCAAAAGGTGTTGGTGGG - Intronic
914540812 1:148611225-148611247 ATTCATCAAAAGGTGTTGGTGGG - Intronic
914625828 1:149460021-149460043 ATTCATCAAAAGGTGTTGGTGGG + Intergenic
915035214 1:152917890-152917912 ACTCATGCAATTATGGAGGTTGG + Intergenic
917073310 1:171176541-171176563 ATTAATGAAATGATAGAGGAAGG - Intergenic
917587967 1:176447005-176447027 TTTCCAAAAAAGATGGAGGTTGG - Intergenic
919186814 1:194161642-194161664 ATTCAGGAAAAGAAACAGGTTGG + Intergenic
919451847 1:197781618-197781640 AATAAAGAGAAGATGGAGGTGGG + Intergenic
921369962 1:214412128-214412150 ATATATGAAAAGATGCAGATGGG - Intronic
922373743 1:224939818-224939840 ATTCAGCAAGAGATGTAGGTGGG - Intronic
922547195 1:226466802-226466824 ATTCAGGAAAAGGTGGAAGCAGG + Intergenic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923995675 1:239491487-239491509 ATTCATGGCAACATGGAGCTTGG - Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1067107944 10:43377982-43378004 ATACATGTGAAGGTGGAGGTGGG - Intergenic
1067269362 10:44775868-44775890 ATTCTTCCAAAGCTGGAGGTTGG - Intergenic
1067370346 10:45676826-45676848 ATTCATGATGAGATGTGGGTGGG - Intergenic
1067841211 10:49680765-49680787 CTTCCTGAGAGGATGGAGGTGGG + Intronic
1068756248 10:60657290-60657312 ATTCAAGACAAGATGTGGGTGGG + Intronic
1068950825 10:62775340-62775362 ATTAATGAAAATATGGAGCCTGG - Intergenic
1072268178 10:93750686-93750708 ATTCATGGCAACATGGATGTTGG - Intergenic
1074325253 10:112444916-112444938 ATTAAAAAAAAGATGGAGGTGGG - Intronic
1075842062 10:125513286-125513308 ATTCATGAAAAGAGTAAAGTAGG - Intergenic
1075843047 10:125520638-125520660 ATTGATGAGGAGATGGAGTTTGG + Intergenic
1076101148 10:127779724-127779746 ATTCAAGAAAAGATTTGGGTGGG - Intergenic
1076825254 10:132963948-132963970 AGGCTTGCAAAGATGGAGGTGGG - Intergenic
1077352079 11:2097689-2097711 ATTAATGAAGAAATGGAGGCTGG - Intergenic
1077729291 11:4711923-4711945 AATCAGGAAAAGAAAGAGGTGGG - Intronic
1079203264 11:18393318-18393340 ATTAAAGAAGAGATGGAGGAGGG + Intergenic
1079282707 11:19102122-19102144 ATTCATGGATGGATGGATGTTGG + Intergenic
1079509112 11:21190054-21190076 ATTTAAGAAAAGATGCAGGCAGG + Intronic
1080306950 11:30846837-30846859 ATTTGTGAAAAGAAGAAGGTGGG - Intronic
1081309657 11:41554355-41554377 ATTCAAGATAAGATTTAGGTAGG - Intergenic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1085361359 11:75890617-75890639 ATTCATGTGTAGATGGAAGTAGG + Intronic
1085464244 11:76713397-76713419 ATGCATGGATAGATGGTGGTGGG + Intergenic
1086438421 11:86803941-86803963 ATTCATGGAATTATGGAGGGTGG - Intronic
1087714468 11:101592761-101592783 ATTCAAGATAAGATGTGGGTGGG - Intronic
1087884772 11:103466572-103466594 AGTAAGGAAAAGGTGGAGGTGGG + Intronic
1088001153 11:104882677-104882699 ATTCAAGATAAGATTTAGGTGGG - Intergenic
1088066364 11:105725570-105725592 ATTAATTAAAAGAAGGAGATTGG + Intronic
1088554088 11:111043964-111043986 AGTCATGAAGAGAGGGAAGTCGG - Intergenic
1088668434 11:112117984-112118006 TTTCCTAAAAAGATGGATGTGGG + Intronic
1088835230 11:113572748-113572770 TTTCATGAAATGATGAGGGTGGG + Intergenic
1089662923 11:119997331-119997353 ATTAAAGAAAATATGGAGGCTGG + Intergenic
1089851433 11:121500214-121500236 ATTGCTGAAAAGCTTGAGGTGGG + Intronic
1092015423 12:5154657-5154679 AGTCATGAAAAGAGGGAGAGTGG + Intergenic
1093971489 12:25380115-25380137 AGTGGTGAAAAGATGGAGATAGG - Intergenic
1095540512 12:43304059-43304081 ATTCAAGAAAAGATTTGGGTGGG + Intergenic
1096299702 12:50416001-50416023 ATCCAAGAAAACATGGAGGGTGG - Intronic
1097700233 12:62812581-62812603 ATTCCTGAATAGAAGTAGGTAGG - Intronic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1098310903 12:69148132-69148154 ATTCATGATAAGATTTGGGTGGG - Intergenic
1098621905 12:72611565-72611587 GTTCATGAAATGAAGGAGCTTGG - Intronic
1098719740 12:73881600-73881622 ATTCATGACGAGATTTAGGTGGG + Intergenic
1098919500 12:76290844-76290866 ATGAATAAAAATATGGAGGTGGG + Intergenic
1099865100 12:88270083-88270105 ATTCAAGATAAGATTTAGGTGGG - Intergenic
1101061447 12:100976705-100976727 TTTAATGAGAAGATGGAGCTTGG - Intronic
1101401926 12:104395985-104396007 ATTCAAGATAAGATGGATTTGGG - Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1104085230 12:125468455-125468477 ATGAATGAAATCATGGAGGTGGG + Intronic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1107766916 13:43745683-43745705 ATTCAAGATAAGATTGGGGTAGG - Intronic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1110277301 13:73654412-73654434 AAACATGAAAAAATTGAGGTTGG + Intergenic
1111082272 13:83327006-83327028 ATTCCTGAAAAGATGGATTATGG + Intergenic
1111177385 13:84613464-84613486 ACGCATGAAATGATGGAGATTGG - Intergenic
1111308708 13:86452153-86452175 ATTCAAGATGAGATGTAGGTGGG - Intergenic
1111742807 13:92225945-92225967 ATTCAAGATAAGATTTAGGTGGG - Intronic
1111913747 13:94339577-94339599 ATGCATGAAAAGATCAAGGGTGG + Intronic
1112284798 13:98094742-98094764 ATTCAGCAAAACATGGAAGTGGG - Intergenic
1112337680 13:98528105-98528127 ATTCATGAGGATATGCAGGTTGG + Intronic
1114554639 14:23554967-23554989 ATTCAGGAAAACATGGGGGTTGG - Intronic
1115085674 14:29512524-29512546 ATTCAAGATAAGATGTGGGTGGG + Intergenic
1116533706 14:46005533-46005555 ATTCATGATAAGATTTCGGTGGG - Intergenic
1117392461 14:55275184-55275206 ATTAACTAGAAGATGGAGGTGGG - Intronic
1117406334 14:55407789-55407811 ATAGGGGAAAAGATGGAGGTGGG + Intronic
1117441899 14:55767818-55767840 ATTCAAGATGAGATGTAGGTGGG - Intergenic
1119451574 14:74716159-74716181 ATACATGAAAGGAGGGAGATGGG + Intronic
1119694470 14:76701716-76701738 ATCCCTTCAAAGATGGAGGTTGG + Intergenic
1119877050 14:78069837-78069859 GGTCATGTGAAGATGGAGGTAGG + Intergenic
1120479597 14:85033697-85033719 ATTCAGGAAAAGATTTGGGTGGG - Intergenic
1121045308 14:90783382-90783404 ATTCTTTATAAGATGGAGGAAGG + Intronic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1121977166 14:98415973-98415995 ACTCAGGAAAGGATGGAGCTTGG + Intergenic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1125259482 15:37806635-37806657 ATTCAAGATAAGATTTAGGTGGG - Intergenic
1125294302 15:38185595-38185617 ATGGAAGAAAAGAGGGAGGTTGG + Intergenic
1127766896 15:62195209-62195231 GTTGAGGAAAAGATGGAGTTTGG + Intergenic
1128301735 15:66570356-66570378 GTTCCTGGCAAGATGGAGGTGGG - Intergenic
1128672499 15:69585130-69585152 GTTTATGATAAGATAGAGGTTGG + Intergenic
1131946882 15:97631940-97631962 ATTCAAGAAAAGATTTGGGTGGG - Intergenic
1132344218 15:101098374-101098396 AATAATTAAAAGATGGAGGCCGG + Intergenic
1133577595 16:7108883-7108905 ATCTGTGAAAAGAAGGAGGTTGG + Intronic
1133745162 16:8680722-8680744 AATAATCAAAAAATGGAGGTCGG - Intronic
1133955573 16:10440699-10440721 TTTCATGATAAAATGGGGGTGGG - Intronic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1134913893 16:18053053-18053075 GTGCATGAAAATGTGGAGGTGGG - Intergenic
1135822953 16:25700803-25700825 ATTAATTAAAAGAAGGTGGTTGG + Intronic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1137385841 16:48041840-48041862 ATTCCCTAAAAGATGGAGGATGG + Intergenic
1138087405 16:54145375-54145397 TTTCTTTAAAAGTTGGAGGTAGG - Intergenic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1139734066 16:68972226-68972248 AAGCAAGAAAAGATGGGGGTGGG + Intronic
1140172860 16:72625412-72625434 ACTCATGAAAACACTGAGGTAGG - Intergenic
1140295268 16:73703634-73703656 ACTCATGAAATGATTCAGGTAGG - Intergenic
1140310918 16:73847551-73847573 ATTCACCAAAGGATGGATGTGGG - Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141899351 16:86980543-86980565 ATGCATGGATAGATGGATGTGGG + Intergenic
1142839913 17:2620075-2620097 ATTTATGAAAATATGGGGCTGGG - Intronic
1143371911 17:6445494-6445516 CTTCATGAAAACAGGGACGTTGG + Intronic
1145756762 17:27397713-27397735 AGTATTGAAAAGATGGAGGCTGG + Intergenic
1146663943 17:34684099-34684121 ATTCAAGACAAGATTTAGGTAGG + Intergenic
1146787976 17:35734861-35734883 ATGCAGGAAAAAATGGAGGAGGG + Intronic
1149052959 17:52328719-52328741 ATTACTGAAAACTTGGAGGTAGG - Intergenic
1150745944 17:67816694-67816716 ATTAATTAAGAGATGGGGGTTGG + Intergenic
1150796659 17:68243785-68243807 ATTCAAAAAAAGATCAAGGTTGG + Intergenic
1156124276 18:33883992-33884014 CGTCATGAAAGGGTGGAGGTGGG + Intronic
1156894339 18:42228447-42228469 ATCCCAGAAAAGACGGAGGTTGG + Intergenic
1157368133 18:47085315-47085337 ATTAAAGGCAAGATGGAGGTTGG - Intronic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1158278492 18:55794687-55794709 ATTCATGGAAAGATTGAGTAAGG + Intergenic
1158832179 18:61291404-61291426 ATTCAAGACAGGAAGGAGGTTGG + Intergenic
1158896430 18:61918399-61918421 AGTCAAGAAAATAGGGAGGTTGG - Intergenic
1159976840 18:74723848-74723870 ATTAAACAAAAGCTGGAGGTTGG - Intronic
1160960283 19:1717886-1717908 ATTCATGGGTAGATGGAGGACGG + Intergenic
1160960326 19:1718084-1718106 ATTCATGGGTAGATGGAGGATGG + Intergenic
1161152994 19:2719474-2719496 GATCCTGAAATGATGGAGGTGGG + Intronic
1161307110 19:3574238-3574260 AACCCGGAAAAGATGGAGGTAGG - Intronic
1161800943 19:6416485-6416507 ATCGAGGAAAAGATCGAGGTGGG - Exonic
1161934568 19:7363755-7363777 ATTGATGAAAGGAAGGAGGATGG + Intronic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1163528584 19:17836206-17836228 AATCATTCAGAGATGGAGGTGGG - Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1166240133 19:41485525-41485547 ATTCATGAAAAATTGGACATTGG + Intergenic
1167208476 19:48118241-48118263 ATTCAAGACAAGATGTGGGTGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1168534599 19:57158481-57158503 AGGCATGGAAAGATGGAGGGGGG + Intronic
1168614330 19:57825662-57825684 ATTTAGGAAATGATGGAGCTTGG + Intronic
926547594 2:14261176-14261198 TTTCAAGAAAATATGGAGGAAGG - Intergenic
928879734 2:36084582-36084604 ATTGATGGAAAGATGGAGAGTGG - Intergenic
928906565 2:36374333-36374355 ATTCTTTAAAAGATGGCAGTGGG - Intronic
929206289 2:39297863-39297885 ATTCATCAAAAAATGAAGGTTGG + Intronic
929336432 2:40752808-40752830 ATTCTTGAAATGATGGACATAGG - Intergenic
929837123 2:45413318-45413340 ATTTATGAAAAGGGGAAGGTTGG + Intronic
929974521 2:46618806-46618828 ATACATGGAAAGATGGTGCTAGG + Exonic
930293833 2:49529447-49529469 ATTCATGATGAGATTCAGGTGGG + Intergenic
930687719 2:54326891-54326913 AGTCATGAAATCATAGAGGTGGG + Intergenic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
931587672 2:63845906-63845928 ATTAATAAAAATATTGAGGTAGG + Intronic
932843876 2:75114860-75114882 ATTCATGAAAATGGGGAGTTAGG - Intronic
933539804 2:83625220-83625242 ATGCATGAAAAGATGTAGCCAGG + Intergenic
938691602 2:133795350-133795372 ATTCATGAAAAAAATGATGTTGG - Intergenic
939544306 2:143534048-143534070 ATTCAAGAAGAGATGTGGGTGGG - Intronic
940082932 2:149825321-149825343 ATTCAAGAAGAGATTTAGGTGGG - Intergenic
941351561 2:164443519-164443541 TTTTATGGAAAGATGGAGATTGG - Intergenic
942383226 2:175415222-175415244 ATTCATTAAAGGAAGGAGGCTGG - Intergenic
943757820 2:191575484-191575506 ACTAATGAAAAGATGGGTGTTGG + Intergenic
943959269 2:194240798-194240820 ATTCAAGATGAGATGTAGGTGGG - Intergenic
944811369 2:203329710-203329732 ATCCCTGGAGAGATGGAGGTGGG - Intronic
944835548 2:203575761-203575783 ATTCATGGAAATAGGGAAGTTGG + Intergenic
1170780824 20:19423873-19423895 GTGCATGATACGATGGAGGTAGG + Intronic
1172811152 20:37649339-37649361 ATACAAGAATAGATGGAAGTGGG - Intergenic
1173171915 20:40733073-40733095 ATTAATGAAAACATGTAAGTGGG - Intergenic
1173270486 20:41529898-41529920 CCTCATGAAAACATGGAGGCAGG - Intronic
1173417723 20:42872482-42872504 CTTCATGAGTATATGGAGGTAGG - Intronic
1174797662 20:53535885-53535907 ATTCACAAAAACATGGGGGTGGG - Intergenic
1174865632 20:54132940-54132962 ATTCACGAAGAGATGGAGTCGGG + Intergenic
1175172488 20:57090342-57090364 ATTCCTTATAAGACGGAGGTAGG + Intergenic
1175351082 20:58318743-58318765 TTTAATGGAAAGATGGAGGGAGG - Intronic
1175754621 20:61521702-61521724 ATTCATAATAAGAGGGGGGTGGG + Intronic
1176692245 21:9928449-9928471 ATTCAAGATGAGATGTAGGTGGG + Intergenic
1177190449 21:17845660-17845682 ATTCTAGACAGGATGGAGGTAGG + Intergenic
1178021930 21:28418324-28418346 ATTCATGTAAAAATGAAAGTTGG + Intergenic
1178787019 21:35663296-35663318 ATACAGGAAAAGATGCAGGGTGG - Intronic
1178989688 21:37342591-37342613 AATCAAGATAAGATGTAGGTGGG + Intergenic
1179586236 21:42375711-42375733 ATCCACGAGCAGATGGAGGTGGG - Exonic
1181147805 22:20861071-20861093 ATACATGAACAGAGAGAGGTGGG - Intronic
1181536826 22:23550642-23550664 ATGCATGAGAAGATGGAAGGAGG - Intergenic
1182285001 22:29241080-29241102 ACTCATGAAAGGAGGGATGTGGG + Intronic
1183023234 22:35044072-35044094 GGTCATGAAAAGCTGGACGTAGG + Intergenic
1184639780 22:45864377-45864399 ATTTAAGAAAAGGTGGGGGTGGG - Intergenic
1184961231 22:47930289-47930311 GTACATGCAAAGCTGGAGGTGGG + Intergenic
949135996 3:566370-566392 ATTCATGAGAATGTGGAAGTTGG - Intergenic
949219986 3:1620460-1620482 CTTCCTGAAAACATGGACGTTGG - Intergenic
950360246 3:12444825-12444847 ATGCTTGAAAACATGGGGGTGGG - Intergenic
950998041 3:17525763-17525785 ATTCAAGAAAACAGAGAGGTAGG - Intronic
951413156 3:22389902-22389924 ATTCATAAAAATATAGTGGTTGG + Intergenic
952123442 3:30271964-30271986 ATTCAAGCCAAGATGGATGTCGG + Intergenic
952681434 3:36098063-36098085 ATGGATGAAATGATGGAGTTAGG + Intergenic
952883519 3:37999347-37999369 ATTCATGTAAAGCTGGACGTGGG + Exonic
953299922 3:41763098-41763120 ATTCAAGATAAGATTTAGGTGGG + Intronic
954597734 3:51841199-51841221 ATCCATCATAAGATGGAAGTGGG + Intergenic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957877539 3:86168441-86168463 ATTGATTAAAAGATGGAGAGTGG - Intergenic
959051869 3:101532088-101532110 ATTCAGGAAAATGTGGAGGTGGG - Intergenic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
959756402 3:109905145-109905167 ATTCATGATAAGATTTGGGTAGG + Intergenic
959931029 3:111982686-111982708 TGTCATCAAAAGAAGGAGGTTGG + Intronic
960336702 3:116426490-116426512 ACACATGAAAAGACCGAGGTTGG + Intronic
960966225 3:123106691-123106713 AGCCCTGAAAAGAGGGAGGTGGG - Intronic
961911060 3:130317052-130317074 ATTCCTGAAATGAAGGAGCTGGG + Intergenic
962888241 3:139648055-139648077 ATTCAAGATAAGATGTGGGTGGG - Intronic
963269245 3:143269180-143269202 ATTCATGAAGAAATGGTGGATGG + Intronic
964545771 3:157831489-157831511 ATTCAGGACAAGAGGAAGGTGGG - Intergenic
965627008 3:170691486-170691508 ATTTATGAAAAGTAGGAGGACGG - Intronic
969047026 4:4343829-4343851 ATTCAAGAAAGGATGAAGGACGG - Intergenic
969862223 4:10046548-10046570 ATTCAAGATGAGATGTAGGTGGG + Intronic
969962967 4:10964788-10964810 ATTCCTGTTAAGATAGAGGTGGG - Intergenic
970389260 4:15591088-15591110 ATTCATAAAAATATGCATGTTGG - Intronic
972816910 4:42655844-42655866 TCACATTAAAAGATGGAGGTGGG + Intronic
974137787 4:57840580-57840602 ATGCACGCAGAGATGGAGGTGGG + Intergenic
974746425 4:66084130-66084152 ATTCAAGATAAGATGTGGGTGGG - Intergenic
974981988 4:68968142-68968164 ATTCAAGATAAGATTTAGGTGGG - Intergenic
976726857 4:88223316-88223338 ATTCAAGATAAGATTTAGGTGGG - Intronic
977383416 4:96307361-96307383 ATTCAAGATAAGATTGGGGTAGG - Intergenic
980240628 4:130169986-130170008 AATCATGAGAAGATGTAGCTAGG - Intergenic
980422880 4:132586172-132586194 ATTCAAGAAAAAATTTAGGTAGG - Intergenic
981437328 4:144740653-144740675 ATTCATGATGAGAGGCAGGTAGG + Exonic
981706920 4:147669455-147669477 ATACAAGAAAAGAGGGAGGATGG + Intronic
983282864 4:165703073-165703095 TTTCATGAGAAATTGGAGGTTGG - Intergenic
983420586 4:167510321-167510343 AGTCATGAAAACTTGGAAGTGGG - Intergenic
983874546 4:172861605-172861627 ATTCAAGATAAGATGTGGGTGGG - Intronic
984694198 4:182763265-182763287 ACTCAAGAAAAGATGGGGGCGGG + Intronic
984891418 4:184497478-184497500 GTCCATGTAAAGATGGAGGCAGG + Intergenic
984927386 4:184818747-184818769 ACTCATGAAAAGATGCACGTGGG + Intronic
985825120 5:2185784-2185806 CACCCTGAAAAGATGGAGGTGGG + Intergenic
986013986 5:3741326-3741348 GTTCATTAAAATATGGGGGTGGG - Intergenic
987352459 5:17033592-17033614 ATTCAAGAAAAGATTTAGGTGGG - Intergenic
989347566 5:40446872-40446894 ATTCAAGATAAGATTTAGGTGGG + Intergenic
990998098 5:61753542-61753564 ATTTAATAAAAAATGGAGGTGGG + Intergenic
991038562 5:62152808-62152830 ATTAATGAAAAGCAGGAGTTTGG + Intergenic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
992168349 5:74077028-74077050 ATTCAAGAAAAGATTTGGGTGGG - Intergenic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993260584 5:85654139-85654161 ATTCAAGATAAGATATAGGTGGG - Intergenic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
993485916 5:88485200-88485222 ATTAATGCAAAGATGAGGGTGGG + Intergenic
993956783 5:94243969-94243991 ATTCCTGAAAAAAGAGAGGTAGG - Intronic
994813647 5:104556310-104556332 ATTCAAGATAAGATGTGGGTGGG + Intergenic
995289123 5:110429306-110429328 ATTCATGAAAAGATACATATAGG + Intronic
996197048 5:120621534-120621556 ATTCATGAAGAGATTTAGGTTGG - Intronic
997115968 5:131126145-131126167 ATTCAAGATAAGATTTAGGTGGG - Intergenic
997656705 5:135560489-135560511 ATTTAATATAAGATGGAGGTAGG - Intergenic
998260232 5:140625146-140625168 AGTCAAGAAATGATGGAGGCCGG - Intergenic
998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG + Intergenic
1000383685 5:160652190-160652212 TTTCATGAAAAGAGGAAGATGGG - Intronic
1000769729 5:165337721-165337743 AATCATGAATAGATGAAGGCAGG + Intergenic
1000838194 5:166182115-166182137 ATGCATGAAGGTATGGAGGTAGG - Intergenic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003353231 6:5340640-5340662 ATAAATGCAAAGATGGAAGTAGG + Intronic
1005169881 6:22971113-22971135 ATTAAAGAAAAGAAGGAGGTTGG + Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1006987812 6:38188343-38188365 ATTCAAGAGAAGATGGTGGCTGG - Intronic
1008110401 6:47486314-47486336 ATTCATCAAAAACTGGAGGGAGG - Intronic
1008461893 6:51785136-51785158 ATTCAATGAAAGAGGGAGGTGGG + Intronic
1009305576 6:62085369-62085391 AATCATTAAAATATGGAGGGTGG + Intronic
1010459175 6:76094385-76094407 ATTCATGATGAGATTTAGGTAGG - Intergenic
1010680101 6:78789065-78789087 ATTCATGGAAAGCTGGAGCAAGG - Intergenic
1011328193 6:86173902-86173924 ATCCAAGCATAGATGGAGGTAGG - Intergenic
1011477524 6:87762640-87762662 ATGCCTGAAAAGATGGAGAAAGG - Intergenic
1011876113 6:91964821-91964843 ATTCAAGATAAGATGTGGGTGGG - Intergenic
1011948895 6:92939559-92939581 ATTACTTTAAAGATGGAGGTGGG + Intergenic
1012235517 6:96809697-96809719 ATTTAGGAAAAGCTTGAGGTTGG - Intronic
1013467713 6:110431816-110431838 ATTCATGACAAAAAAGAGGTAGG + Intronic
1013868624 6:114728399-114728421 ATCCATGAAAAAATGGAGGATGG + Intergenic
1014093013 6:117426749-117426771 ATTTAAGAAAACAAGGAGGTTGG - Intronic
1016184787 6:141184472-141184494 TTTCATGAAAAGATGCATTTAGG + Intergenic
1016682231 6:146844528-146844550 ATTCAAGAAGAGATTTAGGTGGG + Intergenic
1016881803 6:148918999-148919021 AGCCATGCAAAGATGGTGGTGGG - Intronic
1017209228 6:151836535-151836557 ATTCAAGATAAGATTTAGGTGGG + Intronic
1018529735 6:164750060-164750082 ATGCATGGAAAGATATAGGTAGG + Intergenic
1019269266 7:137443-137465 ATTCATGTAAGGAGGGAGTTTGG + Intergenic
1019762139 7:2821038-2821060 GTTGATGAAAACATGGATGTAGG - Intronic
1020477744 7:8618133-8618155 ATCAAAGAAAAGATGTAGGTTGG - Intronic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1020854713 7:13404448-13404470 ATCCATGAAAAAATTGGGGTTGG + Intergenic
1021480073 7:21105812-21105834 ATTCAAGATAAGATTTAGGTGGG + Intergenic
1022823212 7:33981640-33981662 ATTCATGAACAAATGGATGCTGG + Intronic
1023176612 7:37441620-37441642 ATAAATGAAATGAGGGAGGTGGG - Intronic
1025851655 7:65249514-65249536 ATGTATGAAAAGATGGAAATGGG + Intergenic
1026158864 7:67851431-67851453 ATTCATGATGAGATTTAGGTGGG + Intergenic
1026207414 7:68270122-68270144 ATTCAAGATGAGATTGAGGTGGG + Intergenic
1026469571 7:70683607-70683629 ATTCAAGAAAAGCTGTAGTTTGG + Intronic
1026832866 7:73621149-73621171 ATTCCTGAAAGGTGGGAGGTGGG - Intronic
1027161449 7:75805537-75805559 ATTAAAGGAAAGATGGGGGTTGG - Intergenic
1028772632 7:94643903-94643925 AATCTTGAAAAGTTGTAGGTAGG - Intronic
1030367632 7:108663488-108663510 AATCCTGAAAAGATGGAAGTAGG + Intergenic
1030680184 7:112426034-112426056 ATTCATGAAAGGAAGGAGAGAGG - Intronic
1031328321 7:120430689-120430711 CTTCATGAAAATATGTAGTTGGG - Intronic
1031469982 7:122157308-122157330 AATCATGAAAAGAGGAAGGTGGG + Intergenic
1031534665 7:122918381-122918403 ATTCATCAGAAACTGGAGGTTGG + Intergenic
1034215085 7:149398899-149398921 ATTCATGAAATTATGGAGGCTGG - Intergenic
1036118495 8:5987889-5987911 ATTCATGAAAGGATGTGGGGAGG - Intergenic
1036177146 8:6549968-6549990 ATCCATGAAAAGGTTGGGGTTGG + Intronic
1036591136 8:10169271-10169293 CTTCATGAAGAAATGCAGGTTGG - Intronic
1038461521 8:27721113-27721135 ACTCATGAAATGAGGGAGGTGGG - Intergenic
1039263529 8:35799528-35799550 ATTAATTAAAAGATTGAGCTGGG + Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041756922 8:61324175-61324197 ATTCAAGAAAAGATTTGGGTGGG - Intronic
1041902372 8:62996426-62996448 ATTCAAGAAGAGATTTAGGTGGG + Intronic
1043888963 8:85635028-85635050 ATTGATGAAAAGAGCAAGGTGGG + Intergenic
1045944750 8:107783090-107783112 ATTCATGATGAGATTTAGGTGGG - Intergenic
1046016646 8:108613345-108613367 ATTCAGGAAATGATGTTGGTGGG - Intronic
1046331637 8:112723801-112723823 ATTCATGAAAAGATTAAGCAAGG + Intronic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1047361261 8:124171684-124171706 ATTCAAGATGAGATGTAGGTGGG + Intergenic
1047490299 8:125369143-125369165 ATTCATGATAAGATTTGGGTGGG + Intergenic
1047569962 8:126086879-126086901 ATTCAGGAAAAAATGTTGGTTGG + Intergenic
1047737417 8:127778189-127778211 AGTCATGAAAAAAAGGAGGCAGG + Intergenic
1047756432 8:127922567-127922589 ATGAATGCAAGGATGGAGGTAGG - Intergenic
1048394185 8:133997839-133997861 ATTCAAGATGAGATGTAGGTGGG - Intergenic
1048895950 8:138992287-138992309 ATTCAAGATGAGATGCAGGTGGG + Intergenic
1049233401 8:141495862-141495884 ATTTATGAATAGATGGATGTTGG - Intergenic
1049289438 8:141793909-141793931 ATGCATGAAAAGAGAGATGTTGG - Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049935849 9:501345-501367 TTTCAAGAAAAGATGGAGACTGG - Intronic
1050102494 9:2133712-2133734 ATTCATTAAGAGGTGGAGGTGGG + Intronic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1051274565 9:15386643-15386665 TTTCATGAAAAGCTGGGGGTGGG + Intergenic
1051531968 9:18114210-18114232 TTTCATGAAATGATGAAAGTTGG + Intergenic
1052563421 9:30114867-30114889 ATTCAAGATAAGATTTAGGTGGG - Intergenic
1053420586 9:37975069-37975091 ATTCATGAGTGGATGGAGGCAGG - Intronic
1054794445 9:69286761-69286783 TAACATGAAAGGATGGAGGTGGG + Intergenic
1055607889 9:77990100-77990122 ATTCTTGATAAGAAGAAGGTTGG + Intronic
1056779139 9:89536364-89536386 TTACATGAAAATATGGAAGTTGG + Intergenic
1056972379 9:91217272-91217294 ATTAATCAAGGGATGGAGGTAGG - Exonic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057043359 9:91864047-91864069 GTTCAGGAAAAGATGCAGGCGGG + Intronic
1057096004 9:92310378-92310400 GTTCATAAGTAGATGGAGGTAGG - Intronic
1057248255 9:93477482-93477504 ATTCATGAAAACATACAGGAGGG - Intronic
1057451931 9:95171242-95171264 AAACATGAGAAGATGGGGGTTGG - Intronic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1058738655 9:107920700-107920722 ATTAAAGAAAAGAAGTAGGTGGG - Intergenic
1058757337 9:108095482-108095504 AGTCCTGAGAAGATGGACGTGGG - Intergenic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061512762 9:131071084-131071106 TCTGATGAAAAGATGGAGCTAGG + Intronic
1062251207 9:135595526-135595548 AGTAATAAAAAGGTGGAGGTAGG + Intergenic
1062261884 9:135666919-135666941 ATTCACCAAAACATGGAGGCGGG - Intergenic
1062299383 9:135856451-135856473 ATTCAAGAAGAGATTTAGGTAGG + Intronic
1185931279 X:4206042-4206064 ATTCTTGGGAAGAAGGAGGTTGG + Intergenic
1187396741 X:18925951-18925973 ATTCATGAAAAGAAGGGGGCGGG - Intronic
1187621605 X:21062425-21062447 AAGCAGGAAAAGAGGGAGGTAGG + Intergenic
1189956444 X:46279510-46279532 AATGGTGAAGAGATGGAGGTCGG + Intergenic
1190527559 X:51343262-51343284 GTTCATGAAATTATGGAGGCTGG + Intergenic
1192058439 X:67797842-67797864 ACTTATGAAAAGGTGGAAGTGGG + Intergenic
1192239160 X:69315641-69315663 TTTCATAATAAGATGGAGGCGGG - Intergenic
1193918861 X:87400943-87400965 ATTCAAGAAGAGATTTAGGTGGG - Intergenic
1193967893 X:88011065-88011087 CTTAATGAAAAGATGAAGTTTGG - Intergenic
1194870384 X:99124455-99124477 ATTAATCAAAAGATTGAGATTGG + Intergenic
1195084914 X:101404939-101404961 ATTCATTAAAAGATGAAGGCTGG + Intronic
1195122100 X:101765133-101765155 TTACATGAAAAAATTGAGGTTGG + Intergenic
1196800793 X:119541549-119541571 ATTACTGAAAAGATGGAGAATGG - Intronic
1197249400 X:124199157-124199179 ATTCCTGAAAAGTTAGTGGTAGG - Intronic
1197452033 X:126630474-126630496 ATTCAAGAAGAGATGTCGGTTGG + Intergenic
1198261429 X:134968419-134968441 GTTCATGTAAGGATGGAAGTGGG - Intergenic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1200346343 X:155452818-155452840 ATTCATGATGAGATTTAGGTAGG - Intergenic
1201907443 Y:19100222-19100244 AAGAATGAAAACATGGAGGTAGG - Intergenic