ID: 1065835634

View in Genome Browser
Species Human (GRCh38)
Location 10:29655476-29655498
Sequence CTGCTTCGCTCTTGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065835630_1065835634 7 Left 1065835630 10:29655446-29655468 CCAGCAAGCTGCTTATCCCACCT 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG No data
1065835631_1065835634 -9 Left 1065835631 10:29655462-29655484 CCCACCTTCTTCTACTGCTTCGC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG No data
1065835629_1065835634 8 Left 1065835629 10:29655445-29655467 CCCAGCAAGCTGCTTATCCCACC 0: 1
1: 0
2: 0
3: 15
4: 132
Right 1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG No data
1065835632_1065835634 -10 Left 1065835632 10:29655463-29655485 CCACCTTCTTCTACTGCTTCGCT 0: 1
1: 0
2: 2
3: 36
4: 517
Right 1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG No data
1065835628_1065835634 16 Left 1065835628 10:29655437-29655459 CCAGAAGACCCAGCAAGCTGCTT 0: 1
1: 0
2: 5
3: 25
4: 240
Right 1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065835634 Original CRISPR CTGCTTCGCTCTTGCCATGC TGG Intronic
No off target data available for this crispr