ID: 1065836296

View in Genome Browser
Species Human (GRCh38)
Location 10:29661217-29661239
Sequence CTGGTTTGCTTAAAGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065836292_1065836296 2 Left 1065836292 10:29661192-29661214 CCTGAAACACTTGAGTCCTAGAA 0: 1
1: 0
2: 2
3: 8
4: 124
Right 1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG No data
1065836291_1065836296 8 Left 1065836291 10:29661186-29661208 CCTGTGCCTGAAACACTTGAGTC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065836296 Original CRISPR CTGGTTTGCTTAAAGACAAA GGG Intronic
No off target data available for this crispr