ID: 1065837653

View in Genome Browser
Species Human (GRCh38)
Location 10:29673734-29673756
Sequence TAATCCCCACACATCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4017
Summary {0: 1, 1: 13, 2: 163, 3: 962, 4: 2878}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065837653_1065837657 -1 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837657 10:29673756-29673778 ACAATTTCGAGATGAGATTTGGG No data
1065837653_1065837659 3 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837659 10:29673760-29673782 TTTCGAGATGAGATTTGGGTGGG No data
1065837653_1065837660 4 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837660 10:29673761-29673783 TTCGAGATGAGATTTGGGTGGGG 0: 394
1: 8997
2: 12762
3: 9726
4: 6542
1065837653_1065837661 5 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837661 10:29673762-29673784 TCGAGATGAGATTTGGGTGGGGG 0: 17
1: 235
2: 483
3: 465
4: 839
1065837653_1065837656 -2 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837656 10:29673755-29673777 TACAATTTCGAGATGAGATTTGG No data
1065837653_1065837658 2 Left 1065837653 10:29673734-29673756 CCTCCCTCGATGTGTGGGGATTA 0: 1
1: 13
2: 163
3: 962
4: 2878
Right 1065837658 10:29673759-29673781 ATTTCGAGATGAGATTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065837653 Original CRISPR TAATCCCCACACATCGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr