ID: 1065839131 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:29686019-29686041 |
| Sequence | TTGGTCCTAGGGCCAATGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065839131_1065839138 | 16 | Left | 1065839131 | 10:29686019-29686041 | CCACCCATTGGCCCTAGGACCAA | No data | ||
| Right | 1065839138 | 10:29686058-29686080 | GATCAATATGAATTTAAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065839131 | Original CRISPR | TTGGTCCTAGGGCCAATGGG TGG (reversed) | Intronic | ||