ID: 1065839131

View in Genome Browser
Species Human (GRCh38)
Location 10:29686019-29686041
Sequence TTGGTCCTAGGGCCAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065839131_1065839138 16 Left 1065839131 10:29686019-29686041 CCACCCATTGGCCCTAGGACCAA 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065839131 Original CRISPR TTGGTCCTAGGGCCAATGGG TGG (reversed) Intronic
900289967 1:1919643-1919665 TTGGGCATGGGGCCAGTGGGCGG - Intergenic
903817605 1:26076112-26076134 CTGGTCCTGGGGACAGTGGGAGG - Intergenic
907959214 1:59263001-59263023 TTGGACCCTGGGCCAATGAGTGG - Intergenic
913165767 1:116182968-116182990 TTGGGTCTAGGGCCAACGTGAGG + Intergenic
916827587 1:168457526-168457548 TTGTTCTTAGGGCAAATGGGAGG - Intergenic
917469621 1:175315158-175315180 TGAGTCCTAGGGGCACTGGGGGG - Intergenic
919085286 1:192913767-192913789 TTGGGCCCAGCGCCAGTGGGTGG - Intergenic
919131253 1:193453310-193453332 TTGGACCCAGGGGAAATGGGAGG + Intergenic
919801658 1:201358055-201358077 ATGGTCCTTGGGCCACAGGGAGG - Intergenic
920048928 1:203151661-203151683 TTTGTCCTGGGCACAATGGGAGG - Intronic
920591720 1:207225800-207225822 TAGGACCCATGGCCAATGGGAGG - Intergenic
923400436 1:233611363-233611385 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
924775069 1:247110985-247111007 TCGTTCTTAGGGCAAATGGGAGG - Exonic
1064782398 10:18856823-18856845 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1065839131 10:29686019-29686041 TTGGTCCTAGGGCCAATGGGTGG - Intronic
1066618110 10:37316299-37316321 TTGTTCTTAGGGCAGATGGGAGG + Intronic
1069677078 10:70255861-70255883 TGGGTCCTAGGGCCCCTGCGAGG + Intronic
1072761057 10:98057207-98057229 TTGGTCTTAGGTCCAAGAGGTGG + Intergenic
1076703732 10:132289793-132289815 TAGGACCTAGGGCCTTTGGGAGG - Intronic
1081993480 11:47349836-47349858 GTGGTTCAAGGGCAAATGGGTGG - Exonic
1083760464 11:64813830-64813852 TTGGGCTCAGGACCAATGGGAGG + Intergenic
1084084457 11:66848614-66848636 GTGGTCCTAGGACCCAGGGGAGG - Exonic
1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG + Exonic
1094160406 12:27383979-27384001 TCCGTCCGAGGGCCAATGTGTGG + Intronic
1095095337 12:38144856-38144878 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1096111355 12:49031119-49031141 TGGGTCCTAGAGCCAGCGGGGGG - Intronic
1097233532 12:57525863-57525885 CTGGTCCTGGGGCCCCTGGGAGG + Exonic
1104414800 12:128589299-128589321 TTGGTCCTGAGGGCAAGGGGAGG - Intronic
1104756208 12:131270897-131270919 TGTGTCCTGGGGACAATGGGAGG - Intergenic
1104777570 12:131400128-131400150 TGTGTCCTGGGGACAATGGGAGG + Intergenic
1107247949 13:38319898-38319920 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1108301869 13:49085754-49085776 TGGGTTCTAGAACCAATGGGTGG + Intronic
1111196236 13:84877122-84877144 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1115889529 14:38011421-38011443 TTGTTCTTAGGGCAGATGGGAGG - Intronic
1118099498 14:62580664-62580686 TTTGTCCTGGGATCAATGGGCGG - Intergenic
1118362136 14:65065720-65065742 TTGGTCTTGGGGCTAATTGGTGG - Intronic
1120063555 14:80013657-80013679 TGGGTCCAAGAGCCAATGTGTGG + Intergenic
1121501950 14:94444893-94444915 TTGGTGGCAGAGCCAATGGGTGG - Intronic
1125325376 15:38531223-38531245 TAGGTCAAAGGGACAATGGGTGG + Intronic
1126119029 15:45234654-45234676 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1126119969 15:45242664-45242686 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1131659982 15:94503936-94503958 TTGGTGTTAGGGCCTTTGGGAGG - Intergenic
1135075961 16:19393759-19393781 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1135076913 16:19401743-19401765 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1136988027 16:35129994-35130016 TTGTTCTTAGGGCAAATGAGAGG - Intergenic
1138125531 16:54435502-54435524 TTGGTCCTGGAGCCCATAGGAGG - Intergenic
1139434819 16:66930309-66930331 CTGGGCATAGGGCCAAGGGGAGG + Intergenic
1139593156 16:67944169-67944191 GGGGCCCTAGGGCCAGTGGGAGG + Exonic
1141065385 16:80909636-80909658 TTTGTGTTAGGGCCACTGGGAGG + Intergenic
1141177779 16:81732080-81732102 TAGGTCCTGGGGCCACAGGGAGG - Intergenic
1142427961 16:90010871-90010893 CAGGGCCTAGGGCCAAAGGGGGG - Intronic
1144835761 17:18155948-18155970 TTGGACCAAGGGACAAAGGGTGG + Intronic
1149105695 17:52961872-52961894 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1151190054 17:72391791-72391813 TTGGTCCAGGGGCCAGTGGATGG - Intergenic
1155923012 18:31622936-31622958 GTGGACCTAGGGCTAATAGGAGG - Intronic
1157739416 18:50079424-50079446 TTGGTCCAAGGACCAAGGGGTGG - Intronic
1160600913 18:80011983-80012005 TTGTTCTTAGGGCAGATGGGAGG - Intronic
1160949557 19:1658892-1658914 TTGGGCCGAGGGCCAGGGGGCGG + Intergenic
1163101657 19:15100974-15100996 TTTTTCCAAGGGTCAATGGGAGG + Intergenic
1163768744 19:19178191-19178213 TTGGTCCAAGGGTCGATGGGGGG + Intronic
1164289644 19:23855856-23855878 TTGGTCCCAGAGCCATTAGGTGG + Intergenic
1166161734 19:40959109-40959131 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1166888517 19:45975476-45975498 TTGGCTCTGGGGACAATGGGGGG - Intergenic
1167045445 19:47046425-47046447 ATGGACCTAGTGCCTATGGGAGG + Intronic
928673130 2:33622462-33622484 ATGGTCAGAGAGCCAATGGGAGG + Intergenic
930210634 2:48633605-48633627 ATTGTTCTATGGCCAATGGGTGG + Intronic
933362386 2:81304659-81304681 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
934655607 2:96115514-96115536 GAGGTCCCAGGGCCAAGGGGGGG - Exonic
938034780 2:128027324-128027346 TCGGGCGTGGGGCCAATGGGCGG - Intronic
938874912 2:135522271-135522293 TTGTTCTTAGGGCAAATGGGAGG - Intronic
939185946 2:138861112-138861134 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
941972361 2:171365418-171365440 TCGTTCTTAGGGCAAATGGGAGG - Intronic
942830963 2:180237238-180237260 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
944360098 2:198844119-198844141 TTGTTGCTAGATCCAATGGGTGG + Intergenic
1169083059 20:2809230-2809252 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1170949990 20:20927749-20927771 GTAGTCCTAGGGCCAAAGGCTGG + Intergenic
1172480633 20:35269404-35269426 CTGGTCCTCGGGACAGTGGGAGG - Intronic
1172589998 20:36111106-36111128 CTGCTCCCAGGGCTAATGGGGGG - Intronic
1172788793 20:37488033-37488055 TTGGTGCTAAGGCCCATGGAAGG - Intergenic
1173819999 20:46013597-46013619 TTGGACACAGGGCCAGTGGGCGG - Intronic
1175492022 20:59385667-59385689 GTCCTCCTAGGGCCAATGGGAGG + Intergenic
1176870612 21:14080645-14080667 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1184033781 22:41909297-41909319 TGGGTCCAAGGCCCAGTGGGGGG - Intergenic
1185116528 22:48941297-48941319 TTGCTCCTGGGGGCAGTGGGTGG + Intergenic
949772756 3:7596739-7596761 GTGGTGCTAGGGAGAATGGGAGG + Intronic
953621257 3:44534875-44534897 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
953679476 3:45028794-45028816 TTGGTGCCAGGGCCAAGAGGGGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956103497 3:65792683-65792705 TGGGTCCGATGGACAATGGGAGG + Intronic
964269885 3:154944517-154944539 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
970766572 4:19556485-19556507 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
973848723 4:54939665-54939687 TTGGTCCCAGGGTCAGTGTGAGG + Intergenic
976306576 4:83565845-83565867 TTGTTCTTAGGGCAAATGGGAGG + Intronic
979126578 4:116980609-116980631 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
980153892 4:129081255-129081277 TTGTTCTTAGGGCATATGGGAGG - Intronic
980300504 4:130985420-130985442 TTGGGGATAGGGCCTATGGGAGG + Intergenic
980978528 4:139633961-139633983 TTGGTCCTGGGGCCATTAGATGG - Intergenic
982031768 4:151308413-151308435 TGGGACCTAGGGCCTGTGGGGGG - Intronic
984070857 4:175110145-175110167 CTGGTCCTCGGGCCACTAGGTGG - Intergenic
985218868 4:187681677-187681699 TTGGAGCTAGGGCCCTTGGGGGG + Intergenic
988007873 5:25441943-25441965 TTGGACATAGGGCCTATGGGAGG + Intergenic
992145695 5:73845407-73845429 ATGGTCCTGGGGCGGATGGGTGG + Intronic
992344211 5:75859910-75859932 TTGTTCTTAGGGCAAATGGGAGG - Intergenic
993825792 5:92684979-92685001 TTGGAGGTAGGGCCTATGGGAGG - Intergenic
994688128 5:102982358-102982380 TAGGTCCTTGGGCCCAGGGGTGG - Intronic
994917484 5:105999140-105999162 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1005677734 6:28173008-28173030 TTGTTCCTAGAGTTAATGGGGGG + Intergenic
1005810273 6:29509896-29509918 ATGGTCCTGGGGCCAATGGCAGG + Intergenic
1006799759 6:36752421-36752443 TTGGTCCTGGGGCCAGCAGGTGG - Intronic
1008222563 6:48874062-48874084 TTGCTCTTAGGGCACATGGGAGG - Intergenic
1009386072 6:63085124-63085146 TGGGTTCTAGGGCCAGTGAGGGG - Intergenic
1011324132 6:86130091-86130113 TTGGTCCTGTAGCCACTGGGTGG - Intergenic
1019038691 6:169084611-169084633 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1022563161 7:31371084-31371106 TTGGGGCTGGGGCCAAGGGGGGG - Intergenic
1024330174 7:48147431-48147453 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1024335331 7:48201094-48201116 TTGTTCTTAGGGCAGATGGGAGG + Intronic
1029162375 7:98561789-98561811 TTGGTGGTAGAGCCAGTGGGAGG - Intergenic
1034965495 7:155388266-155388288 TTGTTCCTAGGGCCATAGAGTGG - Intronic
1035904257 8:3491997-3492019 TTGTTCTCAGGGCAAATGGGAGG + Intronic
1039333302 8:36562523-36562545 TTGGTCTTAGTGTCAATAGGTGG - Intergenic
1039637915 8:39185823-39185845 TTGGACCTAGAGGCAATGTGGGG + Intronic
1040138461 8:43882668-43882690 TTGCTCTTAGGGCAGATGGGAGG + Intergenic
1041793591 8:61722924-61722946 CTGGTCCTTGGGCCAGTGGTGGG + Intergenic
1050314072 9:4383160-4383182 TTAGGCCTTGGGCCAGTGGGAGG - Intergenic
1052595190 9:30549030-30549052 TCAGTCCTCAGGCCAATGGGTGG + Intergenic
1055994481 9:82142463-82142485 TTGGGCTTTTGGCCAATGGGAGG + Intergenic
1056423281 9:86451223-86451245 TTGGAGCTAGGGCCTTTGGGAGG + Intergenic
1060006849 9:120008032-120008054 TTCCTCCTCTGGCCAATGGGAGG + Intergenic
1060256412 9:122034882-122034904 TTGGTCCTAGAGCCCAGGGAGGG - Intronic
1186600707 X:11034132-11034154 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1187628280 X:21141438-21141460 TAGGTCCTAGAGCCTTTGGGTGG + Intergenic
1192568294 X:72181605-72181627 TTGGTCCAAGAGCCAAAGGACGG + Intronic
1195992639 X:110697892-110697914 TTGGTCCTCGTGCCATTGGTGGG - Intronic
1199011860 X:142768044-142768066 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1199176301 X:144791435-144791457 TTGTTCTTAGGGCAAATGGGAGG + Intergenic
1200872848 Y:8122001-8122023 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1201765870 Y:17573159-17573181 TTGTTCTTAGGGCAGATGGGAGG + Intergenic
1201835682 Y:18332830-18332852 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1201867644 Y:18672174-18672196 TTGTTCTTAGGGCAGATGGGAGG - Intergenic
1202113256 Y:21446432-21446454 TTGTTCTTAGGGCAGATGGGAGG + Intergenic