ID: 1065839138

View in Genome Browser
Species Human (GRCh38)
Location 10:29686058-29686080
Sequence GATCAATATGAATTTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065839136_1065839138 -3 Left 1065839136 10:29686038-29686060 CCAATTTGCCTAACAAAGTAGAT No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data
1065839135_1065839138 4 Left 1065839135 10:29686031-29686053 CCTAGGACCAATTTGCCTAACAA No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data
1065839131_1065839138 16 Left 1065839131 10:29686019-29686041 CCACCCATTGGCCCTAGGACCAA No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data
1065839132_1065839138 13 Left 1065839132 10:29686022-29686044 CCCATTGGCCCTAGGACCAATTT No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data
1065839133_1065839138 12 Left 1065839133 10:29686023-29686045 CCATTGGCCCTAGGACCAATTTG No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data
1065839134_1065839138 5 Left 1065839134 10:29686030-29686052 CCCTAGGACCAATTTGCCTAACA No data
Right 1065839138 10:29686058-29686080 GATCAATATGAATTTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065839138 Original CRISPR GATCAATATGAATTTAAATA TGG Intronic