ID: 1065841469

View in Genome Browser
Species Human (GRCh38)
Location 10:29704810-29704832
Sequence GTCTTTTGGTTTGGGAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 279}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841469_1065841485 23 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841485 10:29704856-29704878 TGGGGATTTTCAGGGGGTTGGGG No data
1065841469_1065841478 14 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841478 10:29704847-29704869 CAGGAGTCCTGGGGATTTTCAGG No data
1065841469_1065841481 17 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841481 10:29704850-29704872 GAGTCCTGGGGATTTTCAGGGGG No data
1065841469_1065841475 4 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841475 10:29704837-29704859 AGACACCTCTCAGGAGTCCTGGG No data
1065841469_1065841486 27 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841469_1065841487 28 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841487 10:29704861-29704883 ATTTTCAGGGGGTTGGGGAAGGG No data
1065841469_1065841473 -5 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841473 10:29704828-29704850 AAGACATGCAGACACCTCTCAGG No data
1065841469_1065841476 5 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841476 10:29704838-29704860 GACACCTCTCAGGAGTCCTGGGG No data
1065841469_1065841483 21 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841483 10:29704854-29704876 CCTGGGGATTTTCAGGGGGTTGG No data
1065841469_1065841479 15 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841479 10:29704848-29704870 AGGAGTCCTGGGGATTTTCAGGG No data
1065841469_1065841480 16 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841480 10:29704849-29704871 GGAGTCCTGGGGATTTTCAGGGG No data
1065841469_1065841474 3 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841474 10:29704836-29704858 CAGACACCTCTCAGGAGTCCTGG No data
1065841469_1065841484 22 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841484 10:29704855-29704877 CTGGGGATTTTCAGGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841469 Original CRISPR GTCTTTTGGTTTGGGAGATT AGG (reversed) Intronic
901154828 1:7128519-7128541 GGCTGTTGGTTTGGAGGATTCGG + Intronic
901189719 1:7402303-7402325 TACTTTTGGGTTGGGAGAGTAGG - Intronic
902056623 1:13606007-13606029 CTCTTTTTTTTTTGGAGATTGGG + Intronic
903626491 1:24734343-24734365 ATCTTTTTCTTTGGGGGATTGGG + Intergenic
903999822 1:27332572-27332594 CTGGTTTGGTTTGGGACATTTGG + Intronic
904719743 1:32499158-32499180 GTGTTTTCCTTTGGAAGATTTGG - Intronic
906810163 1:48818402-48818424 CTTTTTTGGTCTGGGAGGTTTGG + Intronic
907889908 1:58626868-58626890 GGCATTTGGCTTGGGAGACTGGG + Intergenic
908191597 1:61709156-61709178 GTTTTTTGGTTTTTGAGATAAGG - Intronic
909201896 1:72700470-72700492 GACTTTTGGTATAGAAGATTGGG - Intergenic
911578257 1:99603894-99603916 TTTATTTGGTTTGGGTGATTTGG + Intergenic
911927561 1:103854211-103854233 GTCTTTTGATTGGAGAGTTTAGG - Intergenic
912353946 1:109040661-109040683 TACTTTAGGTTTGGGAGATTAGG - Intronic
912495512 1:110088972-110088994 GTCTTTTGGTTGAGGAGCTAAGG - Intergenic
912634396 1:111278555-111278577 TTCATTTGGTTTGAGAAATTGGG - Intergenic
913720701 1:121590539-121590561 GTTTCTTGGTGTGGGAGCTTAGG - Intergenic
914222613 1:145694168-145694190 GTGTTTAGGTTTGGGAGGTGGGG - Intronic
914454334 1:147821685-147821707 GTCTTTGGTTTTGGAAAATTTGG - Intergenic
915642785 1:157242160-157242182 GTCTATTGTTTTTGGACATTTGG + Intergenic
916402923 1:164468476-164468498 CTATTTTGGCTTGGGAGAATAGG + Intergenic
917429048 1:174946464-174946486 GGCTTTTGTTTTAAGAGATTGGG - Intronic
918755369 1:188334733-188334755 GTCTTTTGATTGGGGTGTTTAGG + Intergenic
919737732 1:200963718-200963740 TTCTGTTAGTTTGGGATATTGGG + Intergenic
919863053 1:201755665-201755687 GTAGTGTGGTTTGTGAGATTTGG + Intronic
920567752 1:206989106-206989128 GGCTTTTGGTTTTGGTGCTTTGG + Intergenic
921165117 1:212501422-212501444 GACTTTTGGTTCTGGAGACTGGG - Intergenic
921896384 1:220406230-220406252 GTCCTTTGGTTAGGGAAAGTAGG - Intergenic
922149069 1:222981134-222981156 GTCTTTTCTTTTGGCAGATGTGG - Intronic
923662380 1:235969444-235969466 GTTTTTTGTTCTGGGGGATTTGG - Intergenic
924754654 1:246930925-246930947 GTGTTTTGTTTTGAGAGATGGGG - Intronic
1064026101 10:11850016-11850038 GGCTTGTGGTTTGGGAGGTTGGG - Intronic
1065541723 10:26776582-26776604 GTTTTTTTGTGGGGGAGATTGGG + Intronic
1065841469 10:29704810-29704832 GTCTTTTGGTTTGGGAGATTAGG - Intronic
1067016362 10:42758666-42758688 CTCTGTTGATCTGGGAGATTTGG - Intergenic
1067576667 10:47413350-47413372 GTCTTTGGGTTTGGGATTTGGGG - Intergenic
1067666746 10:48285732-48285754 GTTTTTTGGCATGGGAAATTAGG - Intergenic
1067939283 10:50640024-50640046 GTCTTTTGGCTGGAGAGAGTAGG + Intergenic
1068011866 10:51461983-51462005 GTATTTTCCTTTGGGAGATGGGG - Intronic
1068027424 10:51664341-51664363 GTATTTTTGTTTTGGAAATTTGG - Intronic
1068101138 10:52554546-52554568 GGCTTTTGGTGTAGGAGACTTGG + Intergenic
1068853550 10:61772502-61772524 CTCTTTTTGTTTGAGAGATGGGG - Intergenic
1069497004 10:68914608-68914630 TTTTTTTGGTTTGGGGGAATGGG - Intronic
1070299352 10:75191736-75191758 GTCTTTTGGTTTGGAACAAAAGG + Intergenic
1072603357 10:96954281-96954303 GTCTTTTGGTTTGGTTTATTTGG + Intronic
1073670828 10:105585807-105585829 CTCTTTTGCTGTGGGAGATAAGG + Intergenic
1074797443 10:116962944-116962966 GACTTTTGGTTTTGGAAATGGGG - Intronic
1075025640 10:118981304-118981326 GCCCTTAGGTTTGTGAGATTAGG - Intergenic
1075764609 10:124883322-124883344 ATCTCTTGGTTTGGGATATCTGG + Intergenic
1076304699 10:129456912-129456934 GTATTTTCGTTTGGCAGATTAGG + Intergenic
1077740072 11:4836150-4836172 TTCGTTTGTTTTGTGAGATTGGG + Intronic
1077974693 11:7235614-7235636 GGCTTTTGGTTTCTGAGGTTGGG + Intergenic
1078066836 11:8084123-8084145 GGCATTTGGTTTGGGAGAGAGGG + Intronic
1079965395 11:26973942-26973964 GTATTTTGGTTTTGGTTATTTGG + Intergenic
1080784322 11:35461189-35461211 GGCTTTTGCTTTGGCAGATGAGG - Intronic
1081139563 11:39481966-39481988 GGCTTTTGGTGGGGGTGATTAGG - Intergenic
1081367511 11:42253975-42253997 GTCTTCTGGTTTTGAAGATGTGG - Intergenic
1081858259 11:46317271-46317293 GCCTGTTGGTTTGGGAGAGGAGG + Intronic
1083557584 11:63643794-63643816 GTGTTTTGGTTTGGGGGAACAGG + Intronic
1084049438 11:66590173-66590195 TTCTTTTGATATAGGAGATTTGG + Exonic
1086429069 11:86717790-86717812 GTCTTTTGTTATAGGAGAGTTGG - Intergenic
1090048960 11:123360548-123360570 GCTGTTTGGTTTTGGAGATTTGG + Intergenic
1092839333 12:12524112-12524134 GTCTTTGGGTTTATGAGAATTGG - Intronic
1094726031 12:33117283-33117305 GTCTTTTGGTTAGGGAATGTAGG + Intergenic
1096096626 12:48939821-48939843 GTCTTTTGGTTGGGGGGAGGGGG - Intronic
1096948006 12:55431691-55431713 GGCTTATGGTTTGGCAAATTAGG - Intergenic
1098607647 12:72412215-72412237 GTCTTTCTGTTTGGCTGATTTGG - Intronic
1098974530 12:76888912-76888934 GCAGTTTGGTTTGGGAGGTTAGG + Intergenic
1099067571 12:78002407-78002429 GTCTTCTGGTGTGGAAGCTTTGG + Intronic
1100045699 12:90377551-90377573 GTCTTTTGTTATAGGAGTTTTGG - Intergenic
1100785674 12:98075480-98075502 TTAGTTTGGTTTGGGAAATTTGG + Intergenic
1100897411 12:99199406-99199428 GTTTATTGGTTTGGAAGACTAGG - Intronic
1101333830 12:103778932-103778954 GTGTTTAGGTTTGGGAGATGGGG - Intronic
1102951628 12:117035239-117035261 GAGTTTTAGTTTGGGAGATGTGG - Intergenic
1103183210 12:118933096-118933118 CTCTTTTCGTTTGGGAGTTGTGG + Intergenic
1103353736 12:120304093-120304115 GTGTGTTGTTTTGGGAGAGTAGG + Intronic
1106541560 13:30695176-30695198 GTCATCTGGTTTAGGATATTTGG - Intergenic
1106571198 13:30929607-30929629 GTTTTTTGTTTTTGGAGATGGGG + Intergenic
1107523887 13:41211250-41211272 GTCTTTTTGTTGGAGAGTTTAGG + Intergenic
1109138628 13:58684257-58684279 TTCTTTAGCCTTGGGAGATTGGG + Intergenic
1109255879 13:60081557-60081579 GTCTTTTTTTGTGGGAGATCAGG - Intronic
1110734789 13:78923773-78923795 GTCATTTGGCTTGGGATCTTTGG + Intergenic
1111009186 13:82289726-82289748 GTCTTGTTGTTTGGAAGCTTGGG - Intergenic
1111269443 13:85862219-85862241 CTCTTATAGTTTAGGAGATTTGG - Intergenic
1111661776 13:91220952-91220974 GTCTTGTGGTTGGGGAGATCAGG + Intergenic
1112859236 13:103809830-103809852 CTAATTTGGATTGGGAGATTTGG + Intergenic
1115114669 14:29865650-29865672 GTCTTCTGGTTCTGGAGACTGGG - Intronic
1115479566 14:33848090-33848112 GTCTTTTGATTTTTGAGAATGGG - Intergenic
1117911880 14:60644349-60644371 ATCATTTGGTTTGGGAGCTCAGG - Exonic
1118345634 14:64938857-64938879 GCCCTTTGGTTGGGGATATTGGG - Intronic
1119029318 14:71179383-71179405 GTCTAGTGGCTTGGGAGATCTGG - Intergenic
1119446918 14:74672726-74672748 TTGTTTTTGTTTGGGAGATAGGG - Intronic
1119580611 14:75776154-75776176 GTGTTTGGGTTTGGGAGGTTTGG + Intronic
1119626902 14:76185207-76185229 GTGTTTTGGTTTGGTTGTTTTGG + Intronic
1120729142 14:87982238-87982260 GACTTTTTGTTTTGCAGATTTGG - Exonic
1120893269 14:89508047-89508069 GTGTTTTGTTTTGGGAGGGTGGG + Intronic
1120902899 14:89591113-89591135 GTCTTTTGGTATAGGAGTGTCGG + Intronic
1120903066 14:89592754-89592776 CTCTTTTGGTTTGCTACATTTGG - Intronic
1121077574 14:91082095-91082117 ATCTTTTGGAGTTGGAGATTGGG + Intronic
1121084603 14:91136298-91136320 GTCTTTTGTTTTAGGAGTATTGG - Intronic
1125963845 15:43856493-43856515 GTTTATTGGATTGAGAGATTTGG + Intronic
1126777909 15:52114962-52114984 ATCATTTGCTTTGGCAGATTAGG - Intergenic
1127545069 15:59986007-59986029 TTCTTTTTTTTTGAGAGATTGGG - Intergenic
1128692469 15:69735451-69735473 GACATTTGCTTTGGGAAATTTGG + Intergenic
1129323785 15:74789068-74789090 GTCTAGTGGTTTGGGAGAGGTGG - Intronic
1130716658 15:86341307-86341329 GTCTTTTTGTTTGTGACAATTGG + Intronic
1133030369 16:3008044-3008066 ACCTTTTGGTTTGGGAGCTAGGG + Intergenic
1135525068 16:23207959-23207981 TTTTTTTGGTTGGGGAGATGGGG - Intronic
1135717762 16:24787228-24787250 ATCTTCTGGTTTTGCAGATTTGG + Intronic
1136221734 16:28833691-28833713 GTCTCTAGGTTTGGGTGATCAGG + Intronic
1137829642 16:51531761-51531783 TTCTGTTGTTTTGGGAGTTTGGG - Intergenic
1138310768 16:56021841-56021863 GACTTTTGCTTTGTGAGAATTGG - Intergenic
1140084153 16:71778829-71778851 GAGTTTTGCTTTTGGAGATTTGG - Intronic
1140137669 16:72222127-72222149 GTTTTTTGGTTTGGTTGGTTGGG + Intergenic
1140262643 16:73393679-73393701 GTCCTCTCGTTTTGGAGATTAGG - Intergenic
1143588151 17:7862415-7862437 AACTTTTGGTTTTGGATATTGGG - Intronic
1144525451 17:15985805-15985827 TGCTTTTAGTTTGGGATATTTGG - Intronic
1146024499 17:29307984-29308006 ATCCATTGGTTTGGGGGATTAGG + Intergenic
1146688155 17:34855639-34855661 ATCCTTTGGCTTGGGTGATTTGG - Intergenic
1146805022 17:35858167-35858189 GTCTCTGGGCTTGGGAGCTTTGG + Intronic
1147251516 17:39155217-39155239 GGCTTTTGGTTTGAGAGAAGGGG - Intergenic
1148336627 17:46846456-46846478 GTCCTTGAGTTTGGGAGATTAGG - Intronic
1149075396 17:52591791-52591813 GTCTTTTGATTGGAGATATTAGG + Intergenic
1149469027 17:56901334-56901356 ATGTTTTGGGATGGGAGATTGGG - Intronic
1150511093 17:65753920-65753942 TTCATTGGGTTTGTGAGATTTGG - Intronic
1152443068 17:80321326-80321348 GTATTTTGGATTTGGGGATTAGG + Intronic
1152982901 18:295723-295745 TTCTTTTGGTTTAGGGGCTTGGG - Intergenic
1153577443 18:6536693-6536715 GTCTTTAGATTTTGGAGATTTGG + Intronic
1155106906 18:22676028-22676050 GTATTTTTGATTGGGAGAATAGG - Intergenic
1155110607 18:22710544-22710566 TTCTTTTGAAATGGGAGATTAGG + Intergenic
1157076793 18:44475626-44475648 GTCTTTTTCTTTGGAGGATTTGG - Intergenic
1157240359 18:46003532-46003554 GTCTTTTGGTTAGAGAGAACAGG + Intronic
1157487678 18:48100096-48100118 GACATTTGGTTTGGGGGAGTTGG + Intronic
1158670256 18:59468078-59468100 TTCTTTTTGTTTGGGGGTTTGGG - Intronic
1162898901 19:13782271-13782293 TTTTTTTGTTTTGGGAGATGGGG + Intergenic
1163024139 19:14500072-14500094 TTGTTTTGTTTTGGGAGATAGGG - Intergenic
1168374034 19:55860575-55860597 TTCTTTTGGTTTTTGAGATGGGG - Intronic
925978290 2:9156304-9156326 GTCGTTTGTTTTGAGTGATTTGG + Intergenic
926405893 2:12552113-12552135 TTCTTTTGTTTGGGGAGGTTAGG + Intergenic
927369846 2:22341856-22341878 GTCTTTTGGTAAGTGAGTTTGGG - Intergenic
927868329 2:26607152-26607174 GTCTTGCGTTGTGGGAGATTTGG + Intronic
928878762 2:36072849-36072871 GTCTTTTGGGCTGGGAGTGTTGG + Intergenic
930087032 2:47504754-47504776 GTCTTTGGGTCTGGGAACTTTGG + Intronic
932810696 2:74823331-74823353 GTGTTTTGGTTTCAGAGTTTGGG - Intergenic
933492234 2:83000528-83000550 GTCTGTTGGATTGGGGGCTTTGG + Intergenic
935366598 2:102298155-102298177 ATCTTTTGGTTTAGGGCATTTGG + Intergenic
937594781 2:123660172-123660194 GGGTTGGGGTTTGGGAGATTAGG + Intergenic
937638997 2:124190482-124190504 GATTTTTGGGTTGGGAGACTTGG - Intronic
944527417 2:200634129-200634151 GTCCTTTGGCTAGGGAGAGTGGG + Intronic
944646154 2:201782610-201782632 GTCTTTCCTTTGGGGAGATTAGG - Intergenic
945209692 2:207369299-207369321 GTCTGATGGTTTGGCAGGTTGGG - Intergenic
947722291 2:232377569-232377591 ATCTTTTGGTTTTGGAGACAGGG - Intergenic
948018539 2:234710508-234710530 GTCCTGTGGATTGGGAGGTTGGG - Intergenic
948086472 2:235254286-235254308 ATCTTTTGATTTTGGAGATCAGG + Intergenic
1170389170 20:15853376-15853398 GTATTATGGTTTGGAAAATTGGG - Intronic
1171237611 20:23539954-23539976 GGCTTTGGGTTTGAGAGGTTGGG + Intergenic
1171393261 20:24815052-24815074 TTCTCTTGGTTTGGGATTTTGGG - Intergenic
1176698933 21:10019152-10019174 GTATTATGGTTTTGGAGATGTGG + Intergenic
1177627521 21:23682906-23682928 TTATTTTGTTTTGGGAGGTTGGG - Intergenic
1178279164 21:31266158-31266180 ATCTTATGGTTTGCAAGATTGGG + Exonic
1179563052 21:42228881-42228903 GGCTTTTGGTTGGGGAAATATGG - Intronic
1182926520 22:34130317-34130339 ATCTCTTGGCTTGGGAGATGTGG - Intergenic
950067242 3:10122534-10122556 GTTTTTTGTTTTGGTAGATATGG - Intronic
952701834 3:36336643-36336665 GACTTTATGTTTTGGAGATTTGG + Intergenic
952915565 3:38237164-38237186 GTCTCTAGATTTGGTAGATTTGG - Intronic
953430679 3:42837221-42837243 GTTTTTTTTTTTGGAAGATTGGG + Intronic
953561855 3:43998377-43998399 CTCTTCTGGTGTGGGAGAATGGG - Intergenic
955387235 3:58489403-58489425 ATCTGTTGGTTTGGGGGGTTGGG - Intergenic
955585463 3:60472795-60472817 GTCTTTGGGATTGGGGGCTTTGG - Intronic
955705358 3:61722103-61722125 GTCTTATGGTTTTGGAGGCTGGG + Intronic
955785301 3:62531716-62531738 GGCTGTTGGTTGGGGAGCTTTGG + Intronic
955856370 3:63278097-63278119 GTCTGTTGGTTTGGGAAAGCGGG - Intronic
956472624 3:69583974-69583996 GATTTTTGGTTTGGGAGGTGGGG + Intergenic
956476350 3:69624321-69624343 GTCTTTTGATTGGAGAGTTTAGG - Intergenic
956927985 3:74009983-74010005 GCCATTGGGTTTGGGAGTTTGGG - Intergenic
957061374 3:75483849-75483871 GTCTATTGTTTTTGGACATTTGG + Intergenic
957813514 3:85259685-85259707 CTCCTTTGGTTTGAGTGATTTGG - Intronic
959515194 3:107258277-107258299 GTAATTAGGTATGGGAGATTAGG - Intergenic
960472506 3:118084830-118084852 TTCTTTTGTTTTGGTTGATTTGG + Intergenic
960706637 3:120488693-120488715 GTCTTTAGCTTTGGGAGATGAGG - Intergenic
962045291 3:131752375-131752397 GTCCTTTGGGTAGGGAGAGTAGG + Intronic
963941347 3:151098768-151098790 GTTTTTTGGTCTGTGGGATTGGG + Intronic
964002022 3:151786322-151786344 GTATTAGGGTTTGGGAGATGAGG - Intergenic
964807525 3:160627818-160627840 TTCTTATGGTTTGGGAGGCTGGG + Intergenic
964843000 3:161014836-161014858 ATGTTTTGGTTTGGGATATTTGG + Intronic
965551825 3:169973751-169973773 TTCTTTTGGGTTGAGTGATTTGG + Intronic
966121962 3:176531872-176531894 GTCTTTTGGTGGGAGAGTTTAGG - Intergenic
967117369 3:186354086-186354108 GACTTTTGGATGGGGAGTTTGGG + Intronic
970979171 4:22076770-22076792 GCTTTTTGGGTTGGGAGCTTGGG + Intergenic
971413741 4:26402934-26402956 ATCTTTTGTTTTGGGAGAAGTGG - Intronic
971792656 4:31188463-31188485 GGCTTTGGCTTTGGGAGACTTGG + Intergenic
972069162 4:34993763-34993785 GTCTTTTTGTCTGGTAGACTAGG + Intergenic
973164611 4:47061378-47061400 TACTTTTGGTTTGGTAGATTCGG + Intronic
973636337 4:52864723-52864745 ATGGTTTAGTTTGGGAGATTTGG + Intronic
973873255 4:55187949-55187971 GTCTTTTGGTTAGTGAGAACAGG - Intergenic
974536858 4:63185319-63185341 GTCTTTGGGGTTGGGAGCATTGG + Intergenic
977915104 4:102583489-102583511 GTCTTATGGGTTAGGGGATTAGG - Intronic
978134095 4:105235722-105235744 GTCATTTGATTGGAGAGATTGGG - Exonic
980371398 4:131878471-131878493 GTATTATGGTTTTGGAGATGTGG + Intergenic
980617894 4:135256524-135256546 GCCTTTTGGTGTGGGGGATTGGG - Intergenic
981908572 4:149952445-149952467 ATCCTTTGGGTTGGGAGACTGGG - Intergenic
982121432 4:152146990-152147012 GTCTTTTGTTATGGGAGCATTGG + Intergenic
982551851 4:156811738-156811760 AACTTTTGGTTTGGAAGGTTTGG + Intronic
982922181 4:161289880-161289902 GTCTTTTTGTTTTTGAGATAGGG + Intergenic
984402600 4:179286572-179286594 GTCTTCTGATTTGGGGGCTTTGG - Intergenic
984645920 4:182219654-182219676 TTTTTTTGTTTTTGGAGATTGGG - Intronic
985085056 4:186304858-186304880 CTATTTTGGTTTTAGAGATTAGG + Intergenic
986770627 5:10969668-10969690 TTTTTTTGGTTTTGGAGATTTGG + Intergenic
987904154 5:24053670-24053692 GTCTTTTGATTGGAGAGCTTAGG - Intronic
993752693 5:91690592-91690614 GCCTTTTGGTTGGGTAGAATGGG - Intergenic
993802279 5:92357188-92357210 GCCTTTTAGTTGGGGTGATTAGG + Intergenic
994725021 5:103425044-103425066 GTCTTTTGGTTTGTTGGAATTGG + Intergenic
996981509 5:129501413-129501435 GTCTTTTGCTTTGGGAGGGATGG + Intronic
998249798 5:140544694-140544716 GTCTTTTGGCTTGAGAGTCTTGG - Intronic
998555715 5:143121680-143121702 GTCTTTTCTTTTGGGGAATTGGG + Intronic
999198631 5:149800462-149800484 GTCTTTGGATTTGGAAGATCTGG + Intronic
999554232 5:152722877-152722899 CTGTTTTGGTTGGGGAGATGTGG + Intergenic
999664123 5:153894993-153895015 GTTTTTTTGTTTGGGTGATCAGG - Intergenic
1000641172 5:163703615-163703637 GTGTTTGGGTTGTGGAGATTAGG + Intergenic
1000669169 5:164039381-164039403 TTCTTTTGCTTTTGGAGCTTGGG + Intergenic
1001060234 5:168482119-168482141 CTTTTTTTGGTTGGGAGATTTGG + Intergenic
1002110423 5:176906174-176906196 GTCTGTGGGTTTAGGGGATTGGG - Intronic
1002529215 5:179833897-179833919 GTCTGTAGGTGTGGGAGGTTAGG + Intronic
1003679561 6:8238576-8238598 GTTTTTTGGTTTGGGTTTTTTGG - Intergenic
1005408258 6:25515106-25515128 GTTTGTTGGTTTGGGAAATGGGG + Intronic
1005571162 6:27146980-27147002 GTCTTTTGGATTTGCAGATTGGG - Intergenic
1005971040 6:30762061-30762083 GTCTTTTGTTATGGGAGTATTGG - Intergenic
1007255310 6:40524198-40524220 GTGTTTTGTTTTGGTAGGTTAGG - Intronic
1007404963 6:41629910-41629932 AACTTTTGGTTTGGGAAATATGG + Intergenic
1007412300 6:41672009-41672031 GGTGTTTGGTTTGGGAAATTTGG + Intergenic
1007512926 6:42388351-42388373 GTCTTCTGGTTTTGAAGGTTGGG - Intronic
1007570156 6:42884094-42884116 GGTTTCTGGTTTGGGTGATTGGG - Intronic
1007878425 6:45134094-45134116 TTCTTATGGTTTTGGAGGTTGGG + Intronic
1009750045 6:67870800-67870822 GGGTTGGGGTTTGGGAGATTAGG + Intergenic
1009818653 6:68770861-68770883 ATCTTTTGTTTTGTGACATTAGG + Intronic
1009822555 6:68822631-68822653 GTCCTTTGCTATGTGAGATTTGG - Intronic
1010209226 6:73349729-73349751 TATTTTTGGTTTGGGGGATTGGG + Intergenic
1011085558 6:83536614-83536636 AACTTCTGGTTTGGGAGACTGGG + Intergenic
1011309704 6:85968436-85968458 GTGGTTTGGATTGGGAGGTTTGG - Intergenic
1012561552 6:100586792-100586814 GTCTTTTGGTTTTCAGGATTTGG - Intronic
1013017718 6:106176271-106176293 GTCTTTGGATTTGGCAGTTTGGG - Intergenic
1013485525 6:110592748-110592770 GACTTTTGGGGTGGGGGATTAGG + Intergenic
1016104614 6:140147441-140147463 GTCTTTGGGTTTGGGAATTGAGG - Intergenic
1016869280 6:148800509-148800531 GTCTTATGGTATGAGAGTTTGGG + Intronic
1017454486 6:154588499-154588521 GGCTTTTGATTTGACAGATTAGG + Intergenic
1020900002 7:13991621-13991643 GTTTTGTGGTTTGGGATACTTGG - Intergenic
1021185101 7:17555035-17555057 GCCTTTTGGGGTGGGAGTTTAGG - Intergenic
1023178536 7:37457463-37457485 ATCTTTTCTTTTGGGGGATTTGG - Intergenic
1024003742 7:45210146-45210168 GTTTTTTGGTTTTGGATTTTGGG - Intergenic
1024519423 7:50291234-50291256 GTCTTTAGGTCATGGAGATTGGG - Intergenic
1024830564 7:53450147-53450169 TTCTTTTCTTTAGGGAGATTTGG - Intergenic
1028358233 7:89935605-89935627 TTTTTTTGGTTTGGGAGAGGGGG + Intergenic
1028669679 7:93387233-93387255 GTCCTTTGGTTAGAGAGAGTAGG - Intergenic
1029811963 7:103058319-103058341 GTCTCTTGGTTTGGGGGAAAAGG - Intronic
1031198270 7:118644312-118644334 GCCTATTGATTTGGAAGATTTGG + Intergenic
1031417104 7:121507812-121507834 CTGTTTTGGTTGGGGAGATGTGG - Intergenic
1033489549 7:141828735-141828757 GTCTTGTGGTTTGGGAGCCTAGG + Intergenic
1034194777 7:149238160-149238182 GTTTGTTGGTCTGAGAGATTAGG + Intergenic
1042063623 8:64848741-64848763 GTCTTTAGATTTGGAAGTTTAGG - Intergenic
1042771628 8:72388736-72388758 CTCTTTTGAGTTGGGAGCTTTGG + Intergenic
1044771099 8:95635034-95635056 TTCTTTTGTTTTTTGAGATTGGG - Intergenic
1046667085 8:117015961-117015983 GTCTAATGGTTTGGGAGAAGGGG + Intronic
1046905180 8:119565044-119565066 GTCTCTTGGCTTGTGAGATTTGG - Intronic
1047205700 8:122801743-122801765 CTCTTTTTGTTTTGGAGATGAGG - Intronic
1047309830 8:123682759-123682781 TTCTGTGGCTTTGGGAGATTAGG + Intronic
1047341017 8:123980693-123980715 GTCTTTACCTTTGGAAGATTTGG - Exonic
1048904549 8:139075099-139075121 GTCTTTTCTTTTGGCAGATCAGG - Intergenic
1049351409 8:142166784-142166806 GTTTTTTGGTTTTGGAGATAGGG - Intergenic
1050236853 9:3590796-3590818 GTCTATTGGGTTAGGAGAGTAGG + Intergenic
1050625000 9:7493961-7493983 GCCTTTGGATTTGGGAGACTGGG + Intergenic
1051801821 9:20943416-20943438 GGCTTTGGGTTTGGCAGATGGGG + Intronic
1052412262 9:28136948-28136970 GCCTAATGGTTTTGGAGATTGGG + Intronic
1052824379 9:33164390-33164412 GTCTGTAGGTTTGGGTGGTTAGG - Intronic
1053597056 9:39573484-39573506 GTCTTTTGTTATGGGGGTTTTGG - Intergenic
1053636037 9:40005346-40005368 GTATTATGGTTTTGGAGATGTGG + Intergenic
1053769947 9:41459301-41459323 GTATTATGGTTTTGGAGATGTGG - Intergenic
1053855086 9:42330467-42330489 GTCTTTTGTTTTGGGGGTTTTGG - Intergenic
1054316914 9:63602446-63602468 GTATTATGGTTTTGGAGATGTGG + Intergenic
1054548622 9:66370781-66370803 GTATTATGGTTTTGGAGATGTGG - Intergenic
1054569200 9:66791513-66791535 GTCTTTTGTTATGGGGGTTTTGG + Intergenic
1055727382 9:79245540-79245562 GCATTTTGCTTTGAGAGATTTGG + Intergenic
1055804866 9:80081454-80081476 GTCTTTTATATTGAGAGATTTGG + Intergenic
1055984950 9:82048722-82048744 TTCTTTAGGTTAGGAAGATTAGG + Intergenic
1056238595 9:84620781-84620803 GTCTTTAGGTTTTGGATATATGG + Intergenic
1056313824 9:85369360-85369382 CTCTTTTGGGTGGGGACATTGGG - Intergenic
1187327556 X:18305999-18306021 GTCTTTTGGCTTAGGTGACTGGG - Intronic
1188815687 X:34711260-34711282 GGCTTTTGGTTGGGCAGAATTGG - Intergenic
1189251739 X:39605629-39605651 AACTTTTGGTTTAGGAGACTAGG - Intergenic
1192013275 X:67299067-67299089 GTCTATTGTTTTTGGACATTTGG + Intergenic
1192236008 X:69296490-69296512 GTATTTTGGTTTGCTAAATTTGG - Intergenic
1192478677 X:71466176-71466198 GAATTTTGGTTGGGGGGATTGGG + Intronic
1192685131 X:73296085-73296107 GTTTTTTGGTTGTGGATATTAGG - Intergenic
1194650438 X:96508125-96508147 GTTTTTTGGTTTGGTTGGTTGGG + Intergenic
1195228268 X:102820232-102820254 GGCTTTTGGATTTGCAGATTAGG - Intergenic
1196772129 X:119304863-119304885 TTCTGTTGTTTTGGGAGAGTGGG + Intergenic
1197144123 X:123152485-123152507 GTCTTTTGGTTGTGGAGCTGTGG - Intergenic
1198509277 X:137333160-137333182 ATATTTTGGTTGGGTAGATTGGG + Intergenic
1201456484 Y:14172721-14172743 GCCTCTTGGTTTTGGAGACTGGG + Intergenic
1202040393 Y:20676632-20676654 GTCTTTTAGTTTGGGCATTTAGG - Intergenic
1202041834 Y:20693850-20693872 GTCTTTTAGTTTGGGCATTTAGG + Intergenic