ID: 1065841470

View in Genome Browser
Species Human (GRCh38)
Location 10:29704818-29704840
Sequence GTCTGCATGTCTTTTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 239}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841470_1065841475 -4 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841475 10:29704837-29704859 AGACACCTCTCAGGAGTCCTGGG No data
1065841470_1065841479 7 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841479 10:29704848-29704870 AGGAGTCCTGGGGATTTTCAGGG No data
1065841470_1065841483 13 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841483 10:29704854-29704876 CCTGGGGATTTTCAGGGGGTTGG No data
1065841470_1065841486 19 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841470_1065841476 -3 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841476 10:29704838-29704860 GACACCTCTCAGGAGTCCTGGGG No data
1065841470_1065841478 6 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841478 10:29704847-29704869 CAGGAGTCCTGGGGATTTTCAGG No data
1065841470_1065841487 20 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841487 10:29704861-29704883 ATTTTCAGGGGGTTGGGGAAGGG No data
1065841470_1065841485 15 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841485 10:29704856-29704878 TGGGGATTTTCAGGGGGTTGGGG No data
1065841470_1065841484 14 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841484 10:29704855-29704877 CTGGGGATTTTCAGGGGGTTGGG No data
1065841470_1065841480 8 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841480 10:29704849-29704871 GGAGTCCTGGGGATTTTCAGGGG No data
1065841470_1065841474 -5 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841474 10:29704836-29704858 CAGACACCTCTCAGGAGTCCTGG No data
1065841470_1065841488 26 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841488 10:29704867-29704889 AGGGGGTTGGGGAAGGGAACAGG No data
1065841470_1065841481 9 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841481 10:29704850-29704872 GAGTCCTGGGGATTTTCAGGGGG No data
1065841470_1065841489 27 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841489 10:29704868-29704890 GGGGGTTGGGGAAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841470 Original CRISPR GTCTGCATGTCTTTTGGTTT GGG (reversed) Intronic
906740727 1:48181329-48181351 TACTGCATGTCTTTTGGCTAGGG - Intergenic
911686610 1:100784298-100784320 GACTCCATGTTCTTTGGTTTTGG + Intergenic
912952944 1:114133172-114133194 GTGTGCATGTGTGTTGTTTTTGG - Intronic
913450083 1:118987335-118987357 GTTTGCATTTCTTTTTCTTTTGG - Intronic
918473053 1:184894692-184894714 GTCCCCATGGCTTTGGGTTTAGG - Intronic
920546298 1:206821588-206821610 GTCTGCATGTGTTTTTCTCTTGG + Intronic
920687455 1:208120174-208120196 GTTTTCATTTCCTTTGGTTTTGG - Intronic
922615321 1:226957774-226957796 GTGGGGGTGTCTTTTGGTTTTGG + Intronic
923838539 1:237642173-237642195 ATCTATATTTCTTTTGGTTTTGG + Intronic
1062783327 10:237803-237825 TTATGCCTGTCTTTTGTTTTAGG - Intronic
1064978104 10:21139346-21139368 TTCTGCATTTCTTTTGCTCTTGG - Intronic
1065036150 10:21640740-21640762 TTCTGCATGTCTTTTGAGTTAGG - Intronic
1065238284 10:23678066-23678088 GCCTTCATGTCTTTTGTGTTTGG - Intergenic
1065682645 10:28252898-28252920 ATCTGCATTTCTTTTTTTTTGGG + Intronic
1065841470 10:29704818-29704840 GTCTGCATGTCTTTTGGTTTGGG - Intronic
1067442553 10:46317700-46317722 GTGTGCATGTGTTTTGGGGTTGG - Intronic
1067566437 10:47341139-47341161 GTTTTCTTTTCTTTTGGTTTTGG - Intergenic
1069420705 10:68244087-68244109 GCCTGGCTGTCTTTTGTTTTAGG - Intergenic
1070610662 10:77930130-77930152 GTCTGCTTCTGCTTTGGTTTGGG + Intergenic
1071883967 10:89929630-89929652 GTCTGCATCTCTTGTAGTTTGGG + Intergenic
1072288816 10:93943360-93943382 CTCTGCCTGTCCTTTTGTTTAGG + Intronic
1072939593 10:99748693-99748715 GTCTGGATGTCTTTTCTTCTGGG - Intronic
1076467752 10:130696795-130696817 GTATGCCTGTGTCTTGGTTTGGG + Intergenic
1078769625 11:14336369-14336391 GTCTTTTTGTCATTTGGTTTGGG - Intronic
1080545679 11:33315724-33315746 GTATTCATCTCTTTTGGTATTGG + Intronic
1083246447 11:61431664-61431686 CACTTCATGTCTTTTGGTTGGGG + Intronic
1084256508 11:67946572-67946594 GTCTTCATGTCCTTTGGAATTGG + Intergenic
1084471197 11:69360239-69360261 GTCTGCATGTCTGTTGATACTGG - Intronic
1087854676 11:103077394-103077416 GTATGCATTTCTTTTTATTTCGG - Intronic
1089206136 11:116764594-116764616 GTCTCCATGTCTGTTTGTCTAGG - Intronic
1089872978 11:121693250-121693272 GTCTTTGTGCCTTTTGGTTTAGG + Intergenic
1090238478 11:125165869-125165891 GTTTGCATTTCTTTCGGGTTAGG + Intronic
1091688820 12:2582201-2582223 GTCTGCTTTTCTTTATGTTTTGG - Intronic
1093490115 12:19696297-19696319 GCTTGCATCTCTTTTGGTTTTGG + Intronic
1093818908 12:23586962-23586984 ATCAGCATTTCTTTTGGTGTAGG - Intronic
1094004448 12:25733798-25733820 CTCTCCATGTCTTTGGATTTTGG + Intergenic
1094293372 12:28876866-28876888 GTTTGCAATTCTTTTTGTTTTGG + Intergenic
1096174044 12:49499971-49499993 GTCTACATGACATTTGGCTTTGG + Intronic
1098262098 12:68682241-68682263 GTCTTTTTGTTTTTTGGTTTTGG - Intergenic
1098296517 12:69009901-69009923 GTAGGCGTTTCTTTTGGTTTAGG + Intergenic
1099308382 12:80986942-80986964 ATCTTCATGACTTTTGGATTAGG + Intronic
1100505011 12:95211102-95211124 GTCTTCAGGACTTTTGGTTTTGG + Exonic
1100813497 12:98363168-98363190 GTCTGCATTTCTTTTGGAGTTGG + Intergenic
1101204060 12:102467337-102467359 GTGTAAATTTCTTTTGGTTTGGG + Intronic
1101372677 12:104143864-104143886 GTTTTCATGTCTTTTGAGTTGGG - Intergenic
1101427067 12:104596917-104596939 TTCTGAATGTCTTTGGTTTTAGG + Intronic
1102711297 12:114929946-114929968 GTATTCATTTCTTTTGCTTTTGG + Intergenic
1106085566 13:26538902-26538924 GGCTGCATGTCTTTAGCTGTAGG - Intergenic
1106993395 13:35451090-35451112 ATTTTCATGTGTTTTGGTTTTGG + Intronic
1107327369 13:39259274-39259296 GTTTGTATGTATTTTGGTCTTGG + Intergenic
1108101232 13:46958479-46958501 GTCTGCCTGTATTTTGGAATGGG + Intergenic
1109461158 13:62660010-62660032 GCCTGCATGTCTTTTTTTTAAGG - Intergenic
1111981482 13:95020677-95020699 GACTGTAAGCCTTTTGGTTTGGG - Exonic
1113293520 13:108932354-108932376 TTCTCCATGTTTTGTGGTTTGGG + Intronic
1114791329 14:25661702-25661724 ATTTGCATGGCTTTGGGTTTTGG - Intergenic
1115145827 14:30224658-30224680 GTCTGCATGGCTTATGGCTCAGG - Intergenic
1116315169 14:43377351-43377373 GTCTTCCTATCTTTTGGTTTTGG - Intergenic
1116844603 14:49853547-49853569 TTCTGCATTTCTTTTGTCTTAGG + Intergenic
1118801140 14:69191269-69191291 GTATGTTTGTGTTTTGGTTTTGG - Intergenic
1119171612 14:72540118-72540140 CTCAGCTTTTCTTTTGGTTTTGG + Intronic
1121585321 14:95059344-95059366 ATGAGCATGTCATTTGGTTTGGG + Intergenic
1122514205 14:102295201-102295223 GTCTGTTTTTCTTTTTGTTTTGG - Intronic
1125457385 15:39874003-39874025 TTCTTCATGTCATTAGGTTTTGG - Intronic
1127181152 15:56419734-56419756 GTTTGAATTTGTTTTGGTTTTGG + Intronic
1127509358 15:59624927-59624949 GTGTGTGTGTGTTTTGGTTTTGG - Intronic
1128897309 15:71387091-71387113 GTTTGCTTGTGTTTTGTTTTAGG + Intronic
1130092658 15:80833994-80834016 GGCTGGATGACTTTTTGTTTTGG + Intronic
1130112848 15:80980304-80980326 GTCTGCAAATATTCTGGTTTAGG - Intronic
1131119047 15:89811975-89811997 ACCTTCATGTTTTTTGGTTTTGG - Intronic
1133521943 16:6567122-6567144 CTCTGCATCGCCTTTGGTTTGGG + Intronic
1133656114 16:7866102-7866124 GGCTGCCTTTCTTTTTGTTTGGG + Intergenic
1137512189 16:49111136-49111158 GTGAGCATGGCTTTTGGTGTTGG - Intergenic
1138986887 16:62340253-62340275 GTCAGCAGGTCATGTGGTTTGGG + Intergenic
1140128764 16:72139103-72139125 TGCTGCCTGTCTTTTGGGTTTGG + Intronic
1143126371 17:4643382-4643404 GTTTGCTTGTTTTTTGTTTTTGG + Intergenic
1144288807 17:13805860-13805882 AGCTGCTTCTCTTTTGGTTTTGG + Intergenic
1144645993 17:16973885-16973907 GTGTGCATGTTGTTTGCTTTTGG - Intergenic
1146703956 17:34986307-34986329 GTTTGTTTGTTTTTTGGTTTTGG + Intronic
1148876822 17:50692740-50692762 GTCTGCTTTTCTGTTGGTTCAGG - Intergenic
1149024088 17:52004343-52004365 CTCTCTGTGTCTTTTGGTTTGGG - Intronic
1149325043 17:55521496-55521518 TTCTGCATTCCTTTTGGCTTTGG + Intergenic
1150481655 17:65515934-65515956 GTCTGCATTTCTCTTGTCTTTGG + Intergenic
1151051213 17:70980289-70980311 GTCAGCCTGTCTTTTGTTATGGG + Intergenic
1151243622 17:72777506-72777528 ATCTGTATGTCTCTGGGTTTCGG - Intronic
1151430020 17:74056081-74056103 GTTTGCTTGTCTGTTGTTTTGGG + Intergenic
1153674097 18:7440225-7440247 GTCTTTTTGTTTTTTGGTTTGGG + Intergenic
1153905196 18:9654854-9654876 GCCTGCATGTCATTGGGTTCTGG - Intergenic
1154284183 18:13036285-13036307 GTCTGCTTTTCTTTTGTCTTAGG + Intronic
1154408678 18:14122513-14122535 GTCTGCTTTTCCATTGGTTTTGG - Intronic
1158143468 18:54282815-54282837 GTATGCATTTCTTTTTATTTAGG + Exonic
1158301139 18:56054745-56054767 ATGTGGATATCTTTTGGTTTGGG - Intergenic
1159191977 18:65057903-65057925 GACTGCATGTCTTTTGTCTGTGG + Intergenic
1161667882 19:5587986-5588008 GGCTGCATGTCTTTTTCTTTTGG - Intronic
1162272885 19:9630647-9630669 ATCTGCCTGCTTTTTGGTTTAGG - Intronic
1165374470 19:35432065-35432087 ACCTGCATGTCTCTTGGATTAGG - Intergenic
1165924542 19:39319077-39319099 GTCTGTTTGTGTTTTGGTGTTGG - Intergenic
1167082799 19:47288782-47288804 ATTTGCATGTTTTTTGTTTTTGG - Intergenic
1168055171 19:53859669-53859691 GTATCTATGTTTTTTGGTTTTGG - Intergenic
1168596006 19:57678005-57678027 GTTTGCTTCTCTTGTGGTTTGGG - Exonic
925020073 2:562285-562307 GTTTGCATTTATTGTGGTTTGGG + Intergenic
926381524 2:12295272-12295294 GTCAGCCTGCCTTTTGTTTTTGG - Intergenic
927281449 2:21312221-21312243 GTTTGTGTGTTTTTTGGTTTTGG + Intergenic
933566096 2:83952469-83952491 GTGTGCATTTCTTTTGGAATAGG - Intergenic
933859180 2:86447338-86447360 CCCTGTCTGTCTTTTGGTTTAGG + Intronic
934612593 2:95752163-95752185 GTGTGCATCTCTCTTGCTTTAGG + Intergenic
934648322 2:96072260-96072282 GTGTGCATCTCTCTTGCTTTAGG - Intergenic
935701619 2:105817191-105817213 GTCTGCATCTCATTTGATGTAGG - Intronic
940286913 2:152041640-152041662 ATCTCCATGTCTTTTGGTGATGG - Intronic
940435918 2:153654166-153654188 TTCTGCATTTCTTTAGGATTTGG - Intergenic
945547150 2:211169681-211169703 GACTGCCTGTCCTGTGGTTTTGG + Intergenic
946769122 2:223070213-223070235 CTCTGCATCTTTTTTGGATTAGG - Intronic
948746852 2:240102952-240102974 GTTTCCATTTGTTTTGGTTTGGG - Intergenic
1172832660 20:37849198-37849220 GTCTGCCTATCTGTAGGTTTGGG + Intronic
1174806205 20:53606503-53606525 GTCAGCATGGCTTTTGGCATTGG - Intronic
1175117214 20:56691032-56691054 GTCTGCCTGCCTCTTGTTTTAGG + Intergenic
1175356933 20:58375915-58375937 GTCTGCGTGTCTTTTGTCTCTGG + Intergenic
1176703420 21:10087874-10087896 GTCTGTATTTCTTGTAGTTTTGG - Intergenic
1179064830 21:38015189-38015211 GTCTGCTTGGCTTTAGCTTTGGG - Intronic
1180032038 21:45218557-45218579 GTCTGCATGTCTCTTCCTTCCGG + Intronic
1184451112 22:44583391-44583413 GTCTGCTTGTGTTTTGATCTTGG + Intergenic
950795194 3:15504877-15504899 GACTGTATTTCTTTTGGTTTTGG - Intronic
950825622 3:15817045-15817067 GTTTGGGTTTCTTTTGGTTTTGG - Intronic
951568102 3:24032734-24032756 GTGTCCTTTTCTTTTGGTTTTGG + Intergenic
951685973 3:25345213-25345235 CTCTGGAGGTTTTTTGGTTTGGG + Intronic
952246036 3:31593965-31593987 CTTTGCATGTCTTATAGTTTTGG + Intronic
952359475 3:32615394-32615416 GTCTGGATGGCTCTTTGTTTTGG + Intergenic
952503847 3:33989538-33989560 ATCTGCATGGCTTTGGGGTTGGG + Intergenic
952784877 3:37143235-37143257 ATCTGCTTGTCTTATGTTTTAGG - Intronic
953287414 3:41625830-41625852 GTCTTCATTTTGTTTGGTTTTGG - Intronic
954002006 3:47565262-47565284 GTTTGCATATCTCTTGCTTTTGG - Intronic
954387779 3:50253317-50253339 GCCTTCCTGTTTTTTGGTTTGGG + Intronic
955930395 3:64050380-64050402 GTCAGTATATCTTTTGCTTTAGG + Intergenic
956376245 3:68616371-68616393 GTCTGTCTGTCTTGGGGTTTGGG - Intergenic
957071413 3:75570600-75570622 GTCTTCATGTCCTTTGGAATTGG + Intergenic
958510177 3:95037749-95037771 GATTGCATGTCTTTTGTGTTTGG + Intergenic
959305539 3:104660443-104660465 GTCTGCATTTCTTTAGCTTTAGG - Intergenic
959394573 3:105821165-105821187 GTTTGGATGTATTTTGTTTTTGG - Intronic
960351351 3:116597117-116597139 GTCTGCATGTTTTCAGGTTCTGG + Intronic
960694937 3:120386878-120386900 GTCTGCATGTCCTTTCATTTTGG - Intergenic
960737622 3:120798008-120798030 GTTTGCATGTCTTTGTGTTAGGG - Intergenic
963134094 3:141884726-141884748 GACTCCATGTTCTTTGGTTTTGG + Intronic
963733471 3:148993292-148993314 GGGTGCGTGTCTGTTGGTTTGGG + Intronic
965736157 3:171823282-171823304 GTTTGCCTGTCTTTTGCTTTTGG - Intergenic
966396435 3:179508513-179508535 ATCTGCATTTTTATTGGTTTTGG - Intergenic
969015021 4:4098255-4098277 GTCTTCATGTCCTTTGGAATTGG + Intergenic
969798107 4:9541637-9541659 GTCTTCATGTCCTTTGGAATTGG - Intergenic
971985962 4:33824385-33824407 GTCTGCAGTTCTTTTGATCTTGG + Intergenic
972286075 4:37649599-37649621 GTCTGCATGGCCTGTGGTTTCGG - Intronic
972352927 4:38253744-38253766 GTCTGAAGGTTTTTTTGTTTTGG + Intergenic
972838062 4:42899164-42899186 TTCTCCATCTCTTTTGGGTTTGG + Intronic
974566986 4:63590554-63590576 GTGTGGATGTCTTTTTGTTGAGG - Intergenic
974813572 4:66977042-66977064 TTCTATATTTCTTTTGGTTTGGG - Intergenic
975937551 4:79600131-79600153 TTCAGAATGGCTTTTGGTTTGGG - Intergenic
976639204 4:87319775-87319797 GTCTCCATGTCCTATGGTTATGG - Intronic
979580181 4:122349222-122349244 ATCAGCATGTCTGTTGGTCTGGG + Exonic
980595008 4:134943041-134943063 TTCTCCTTGTTTTTTGGTTTGGG - Intergenic
981005379 4:139869573-139869595 GTCTGCATGCCTTTTGATCATGG - Intronic
982646450 4:158029854-158029876 GTTTGTTTGTTTTTTGGTTTTGG - Intergenic
983118428 4:163849757-163849779 CTCTGCATTTTTTTTGTTTTTGG + Intronic
983403794 4:167299534-167299556 TTCTGTATGTCTTTCAGTTTGGG - Intergenic
984407943 4:179357728-179357750 TTCTGCATTTCTTTTGGCTGTGG - Intergenic
984812817 4:183809782-183809804 GTCTGTATGTTTTTCTGTTTTGG - Intergenic
986693219 5:10331005-10331027 GTTTGCAAGTCTTTTGGTTTGGG - Intergenic
988149798 5:27363392-27363414 GTCAGGATTTCGTTTGGTTTTGG - Intergenic
990243134 5:53836088-53836110 GTCTTCATTTCTCTTGGTTTAGG - Intergenic
990462991 5:56047006-56047028 GTCTGCATGTCTTGTTCTGTTGG - Intergenic
990595918 5:57312469-57312491 GTTTGCATGTCTGTTATTTTGGG - Intergenic
991455742 5:66801649-66801671 GGCTGCCTGTCTTTTCTTTTTGG + Intronic
992542423 5:77778060-77778082 GTGTGCATGTCATTTTGCTTTGG - Intronic
995537128 5:113147818-113147840 GTCGGCATGTATTTTTGTTAGGG - Intronic
995680023 5:114705468-114705490 TTCCTCATGTCTTTTGGTTCTGG - Intergenic
996281117 5:121730084-121730106 GCCTGCATCATTTTTGGTTTTGG + Intergenic
996577695 5:124994239-124994261 GTCTGCATTTCTTTTTTTGTGGG + Intergenic
997051434 5:130385750-130385772 GTCTGAATGTTTTTCTGTTTTGG - Intergenic
997580102 5:135011801-135011823 GTCTGCATGTCCTGTGGTGGGGG - Intergenic
998095404 5:139393391-139393413 CTCTGCATCTCTGTTGGTTCTGG + Exonic
998323682 5:141258508-141258530 GTCTACATGTCTTATGCTTAAGG + Intergenic
999297319 5:150467972-150467994 GTCTTCGTGTCTTATGGTTTGGG - Intergenic
999956027 5:156702766-156702788 TTCTGCATGTCTTTTGAGTGAGG + Intronic
1000268932 5:159664579-159664601 CTGTCCATGTCCTTTGGTTTGGG + Intergenic
1000689901 5:164304459-164304481 GTGTGCATGTATTTTTTTTTTGG + Intergenic
1000801733 5:165736486-165736508 GTATGCATTTCTTTTTCTTTGGG + Intergenic
1000994683 5:167946640-167946662 GTGTGCCTGTGTTCTGGTTTTGG + Intronic
1001416398 5:171547448-171547470 GTGTGCATGTGTCTTGGTATGGG - Intergenic
1002482147 5:179509083-179509105 ATCTGCATTTATTTTGGTGTAGG + Intergenic
1003528624 6:6919466-6919488 GTCTTCTGGTTTTTTGGTTTAGG + Intergenic
1004166540 6:13261755-13261777 GTCTGCAAATCTCTTGGTTTAGG - Intronic
1004584141 6:16983181-16983203 GTCTGCATGCCATTTGGATTAGG - Intergenic
1004771903 6:18793252-18793274 GCATGCATTTCATTTGGTTTAGG + Intergenic
1007739931 6:44004072-44004094 GTCTGCATGTTTCTTGGTAAGGG + Exonic
1009809328 6:68640097-68640119 CTCTCCAGGTCTTTTGGTTCTGG + Intronic
1010066115 6:71684429-71684451 GTGTGCAGGACTTTTGGTTCTGG + Intergenic
1010285012 6:74066723-74066745 GACTTCATGTCTTGTGGTTTGGG + Intergenic
1010484973 6:76399882-76399904 GTTTTCATTTGTTTTGGTTTCGG - Intergenic
1011243716 6:85299751-85299773 CTCTGAATGTATTCTGGTTTGGG - Intergenic
1012910475 6:105112217-105112239 TTCTGCATATGTTTTTGTTTTGG - Intronic
1013171981 6:107644875-107644897 ATCTGCATGTATTTTTGGTTTGG - Intronic
1013458453 6:110353948-110353970 ATCTGCATGTGTTTCTGTTTGGG - Intronic
1014164609 6:118209293-118209315 GTCAGCCTGTCTTTTGGTATAGG + Intronic
1014527132 6:122514250-122514272 GTATGCTTTCCTTTTGGTTTGGG + Intronic
1015819858 6:137249361-137249383 GTCTGCCTGTGTGTTGGTCTTGG - Intergenic
1017680894 6:156862719-156862741 GACTGCATGTCTTGTTGTGTGGG + Intronic
1019045301 6:169140954-169140976 ATCTGTGTGTCCTTTGGTTTGGG + Intergenic
1019173694 6:170149015-170149037 GTCTGCATTCCTGTTGGTCTTGG - Intergenic
1020027236 7:4907678-4907700 ATCTGCATGTCTTTTGGTTTTGG - Intronic
1020548799 7:9571538-9571560 TTTTACATGTATTTTGGTTTTGG - Intergenic
1022192526 7:28030763-28030785 GTCTCTCTCTCTTTTGGTTTAGG + Intronic
1023442845 7:40202475-40202497 GTCTGCATGTCTATGTGTTTCGG + Intronic
1023772564 7:43571683-43571705 GTTTGCTTGTTTTTTTGTTTTGG - Intergenic
1026069427 7:67104938-67104960 GCCTGGAAGTCTTTTGGTCTTGG + Intronic
1026451778 7:70535807-70535829 CTCTGCATGTCTTTTGGTGGAGG - Intronic
1026707478 7:72707375-72707397 GCCTGGAAGTCTTTTGGTCTTGG - Intronic
1028912357 7:96222868-96222890 TTTTGGATGCCTTTTGGTTTTGG - Intronic
1028925287 7:96350783-96350805 ATCTTTATGACTTTTGGTTTTGG + Intergenic
1030050064 7:105529987-105530009 GTCGTCATTTGTTTTGGTTTTGG - Intergenic
1030186570 7:106768264-106768286 GTCTGAATCTATTCTGGTTTGGG + Intergenic
1031247209 7:119329691-119329713 GGGTGCATGTCTTTTTGCTTAGG + Intergenic
1031793012 7:126134174-126134196 GTTTGCTTGTATGTTGGTTTGGG + Intergenic
1031907432 7:127475991-127476013 GTCTGCATGTCTATGGGTGGTGG - Intergenic
1033481906 7:141750971-141750993 TTCTTCATATCTTTTGTTTTTGG + Intronic
1033482545 7:141756252-141756274 TTCTTCATATCTTTTGTTTTTGG + Intronic
1036126225 8:6065184-6065206 GTCTACAACTCTTTGGGTTTAGG + Intergenic
1036244001 8:7101356-7101378 GTCTTCATGTCCTTTGGAATTGG - Intergenic
1037284728 8:17287142-17287164 CTCTGCATCTGTTTTGTTTTAGG + Intronic
1037567044 8:20126781-20126803 CTCTGCATCTCTTTTGTTTCAGG - Intergenic
1037871609 8:22502682-22502704 GTCTGCCTGTCTTTTGTTTTTGG - Intronic
1040994872 8:53391318-53391340 GTCTCCATTTCTTTTTTTTTTGG - Intergenic
1043413355 8:80022939-80022961 TTCTGTATGTATTTTGTTTTTGG - Intronic
1044633863 8:94303254-94303276 GACTCCAAGTCCTTTGGTTTTGG - Intergenic
1044805013 8:95997356-95997378 CTTTGCATCTCTTTTGGTCTTGG - Intergenic
1045158734 8:99511479-99511501 GGCTGCATTTCTTCTGTTTTTGG - Exonic
1047323815 8:123817165-123817187 GTCTTCGTGTCCTGTGGTTTGGG + Intergenic
1047360739 8:124166616-124166638 TTCTTCATGCCTTTTAGTTTTGG + Intergenic
1048622927 8:136154289-136154311 GTTTGTTTGTTTTTTGGTTTGGG - Intergenic
1050045120 9:1534944-1534966 TTCTGTTTGCCTTTTGGTTTTGG - Intergenic
1050860550 9:10423821-10423843 CACTGCATGTTTTTAGGTTTGGG + Intronic
1052715668 9:32113982-32114004 GTTTGCATATATTTTTGTTTAGG - Intergenic
1055045329 9:71918238-71918260 GTTTGCTTGCCTTTTGTTTTGGG + Intronic
1055803443 9:80066640-80066662 GTCTGGATGTGTTTTGGGATGGG - Intergenic
1055943181 9:81669618-81669640 GTGTGCATGTCTTTTGGTGTGGG - Intronic
1055951477 9:81733639-81733661 TTCTGCTGGTCTTCTGGTTTAGG + Intergenic
1056587013 9:87934362-87934384 GCCTGCCTGTCTGTTGTTTTAGG - Intergenic
1056609861 9:88118574-88118596 GCCTGCCTGTCTGTTGTTTTAGG + Intergenic
1057162492 9:92898751-92898773 GCCTGCCTGTCTGTTGTTTTAGG - Intergenic
1057489848 9:95512103-95512125 GGCTGCATGTCCTCTGGTTCCGG + Intronic
1057703645 9:97382474-97382496 GTCTGCACCTCTTTTAGTCTAGG + Intergenic
1058793440 9:108473546-108473568 GTCTGCATGTTTTTTTGTTTTGG + Intergenic
1058898057 9:109416975-109416997 TTCTGCATGTCTCTTTCTTTAGG + Intronic
1058946645 9:109863454-109863476 GACTGCATGTGTTTGAGTTTGGG + Intronic
1059555150 9:115273039-115273061 GTCTGCAATTCTTATGGTTCTGG + Intronic
1059645293 9:116260221-116260243 TTCTTCATATCTTTTGTTTTTGG - Intronic
1059927404 9:119224386-119224408 TTCTGAATGTATTTGGGTTTGGG - Intronic
1060591321 9:124818862-124818884 GTCTGCATGTCATGTGCTGTGGG + Intergenic
1202788456 9_KI270719v1_random:57974-57996 GTCTGTATTTCTTGTAGTTTTGG - Intergenic
1186231092 X:7454759-7454781 GTCTGCTTGTTTTTTTGATTGGG + Intergenic
1186320126 X:8415115-8415137 GTCTGCATCTCTCCTTGTTTGGG - Intergenic
1188580384 X:31704661-31704683 GTATGTGTGTCTTTTTGTTTGGG - Intronic
1189910142 X:45802758-45802780 GTTTTTGTGTCTTTTGGTTTTGG - Intergenic
1192593812 X:72385473-72385495 GTTTGCTTGTTTTTTCGTTTTGG - Intronic
1193497613 X:82233615-82233637 GTGTGCATGTCTGCTGGGTTTGG + Intergenic
1194053388 X:89100685-89100707 GACTGTATGTCTTTTGTGTTTGG + Intergenic
1194086522 X:89534895-89534917 GTCTGCTTCTATTTGGGTTTTGG + Intergenic
1196512997 X:116534659-116534681 GTGAGCATGAATTTTGGTTTGGG + Intergenic
1199419205 X:147623924-147623946 GTTTGCTTGTCTTTTGAATTTGG + Intergenic
1200439185 Y:3190770-3190792 GTCTGCTTCTATTTGGGTTTTGG + Intergenic